Download diapositivas de la presentación

Document related concepts

Empalme alternativo wikipedia, lookup

Exón wikipedia, lookup

Regulación de la expresión génica wikipedia, lookup

ARN mensajero wikipedia, lookup

Genómica funcional wikipedia, lookup

Transcript
Sobre los genes y las ideas sobre los
genes
Alberto Kornblihtt
Facultad de Ciencias Exactas y Naturales – UBA
IFIBYNE-CONICET
Todos los seres vivos estamos
compuestos por células
Toda célula proviene de otra célula
Es muy probable que todos los seres
vivos provengamos de una única
célula original: origen monofilético de
la vida
Figure 6-98 Molecular Biology of the Cell (© Garland Science 2008)
Figure 1-21 Molecular Biology of the Cell, Fifth Edition (© Garland Science 2008)
Podemos pensar a la biología como la
ciencia que se ocupa de las similitudes
y las diferencias en el mundo vivo
Moluscos
Sin caparazón
sin “pluma”
pulpo
Con caparazón
con “pluma”
calamar
almeja
vertebrados
peces
mamíferos
amigable
tiburón
delfín
no tanto
orca
Homo sapiens sapiens
Piel negra
Magic Johnson
Piel blanca
Manu Ginobili
Fuente: NBA Entertainment, 2005
Criaturas del planeta Pandora creado por James Cameron
Na’vi (4 dedos)
Neytiri
Avatar
(5 dedos)
Jake Sully
Fuente: www.cinematicwallpaper.com/movie-pictures/wallpapers/Avatar_wallpaper/Avatar.jpg
Sin embargo…
Fenotipo = Genotipo + Ambiente
aspecto
morfología
fisiología
comportamiento
ADN
eso mismo
El material genético de todas las células es ADN
(= DNA)
ADN = ácido
desoxirribonucleico
Fuente: Alberts et al. MBOC, 5th edition, Garland, 2008
TTATCGAGCTGCCTAAATGTGCTCACGCATTGC
AATAGCTCGACGGATTTACACGAGTGCGTAACG
GENOMA HUMANO
24 cromosomas distintos (22 + X + Y)
3.000.000.000 de "letras"
70 % de regiones NO génicas
30 % son genes
1,5% regiones
codificantes
23.000 genes
0,037% de variabilidad intraespecífica
Francis Crick (1916-2004)
Premio Nobel 1962
James Watson (1928-)
Premio Nobel 1962
1953
Revolución en la medicina
Fuente: Jane Ades , NHGRI, NIH, USA
diagnóstico de enfermedades
hereditarias, infecciosas, cáncer
vacunas
recombinantes
remedios producidos por
tecnología de ADN recombinante:
interferón, eritropoyetina, hormona
de crecimiento, insulina
terapia génica
anticuerpos
monoclonales
animales transgénicos
medicina personalizada
medicina forense
determinación de identidad
y lazos familiares
Fuente: Jane Ades , NHGRI, NIH, USA
Revolución en la industria y en la agricultura
Nueva industria farmacéutica de
ADN recombinante
plantas transgénicas
sojización
superávit fiscal
argentino
producción de
enzimas de uso
industrial
tipificación semen
reproductores
animales transgénicos
detección de
contaminación en
alimentos
identificación de
ganado robado
Los principales productos de los
genes son proteínas
¿Cómo se fabrican?
Dogma (?!) central de la biología
molecular
o
Flujo de información genética
retro-transcripci—n
traducci—n
duplicaci—n
transcripci—n
DNA
PROTEêNA
RNA
cromosoma
célula
gen
ADN
copiado I
Ácido ribonucleico (ARN)
copiado II
proteína
función
Los genes no sólo codifican proteínas
LOS GENES NO SÓLO CODIFICAN PROTEÍNAS
GENES
RNA
RNAs
RIBOSOMALES
RNAs DE
TRANSFERENCIA
RNAs
micro RNAs
NUCLEARES
PEQUEÑOS
siRNAs
sncRNA
RIBOZIMAS
RNAs
MENSAJEROS
PROTEÍNA
PROTEÍNA
Fenotipo = Genotipo + Ambiente
Un gen
Exón
Intrón
Exón
Intrón
Exón
ADN
Pol
TRANSCRIPCIÓN
ARN inmaduro
(exones + intrones)
splicing
intrones
ARN mensajero
(sólo exones)
TRADUCCIÓN
proteína
¿Cómo es posible que si todas las
células de un individuo tienen los
mismos genes, se produzca la
diferenciación celular?
EN UN DETERMINADO TIPO CELULAR Y/O EN UN
DETERMINADO MOMENTO DEL DESARROLLO SÓLO SE
EXPRESA UN SUBCONJUNTO DE LOS GENES
GENOMA
TRANSCRIPTOMA
PROTEOMA
Genética:
Cambios heredables en la información (secuencia del
DNA) de los genes. Incluidos en los que llamamos
genotipo. Irreversibles.
Epigenética
Sensu stricto: cambios heredables en los patrones de
expresión de los genes que no son causados por cambios
en la secuencia de DNA. Provocados por señales
externas. Reversibles. Incluidos en los que llamamos
fenotipo.
Sensu lato: cualquier modificación covalente de las
histonas o del grado de metilación del DNA que afecte la
expresión de los genes sin alterar su secuencia.
Figure 4-33b Molecular Biology of the Cell (© Garland Science 2008)
Figure 4-33a Molecular Biology of the Cell (© Garland Science 2008)
Modificaciones post-traduccionales de histonas
Figure 4-39b Molecular Biology of the Cell (© Garland Science 2008)
Modificaciones post-traduccionales de la histona H3
Figure 4-44a Molecular Biology of the Cell (© Garland Science 2008)
H3
H3
H3
H3
Figure 4-44b Molecular Biology of the Cell (© Garland Science 2008)
Introducción de “marcas” covalentes en histonas: “writing”
Eliminación de “marcas” covalentes en histonas: “erasing”
Reconocimiento de las marcas en las histonas: “reading”
Las marcas en las histonas afectan el grado de
compactación de la cromatina y consecuentemente la
accesibilidad de factores de transcripción y de la RNA
polimerasa II
Heredabilidad
(condición requerida para la definición de epigenética sensu
stricto)
-Mitótica (metilación del DNA y H3K27me)
-Meiótica (transgeneracional) ????
Lamarck
Figure 4-35 Molecular Biology of the Cell (© Garland Science 2008)
Splicing alternativo
GENOMA
TRANSCRIPTOMA
PROTEOMA
Un gen
Exón
Intrón
Exón
Intrón
ADN
Exón
Pol
TRANSCRIPCIÓN
ARN
splicing alternativo
ARN mensajeros
(2 variantes)
TRADUCCIÓN
proteínas
(2 variantes)
un gen
una proteína
un gen
muchas proteínas
Examples of alternative splicing
AUG
Thyroid
3
3
2
AUG
AATAAA
AATAAA
4
5
6
Neurons
fruitless
Calcitonin/CGRP
Embryo
Binds KGF
VASE
7
8
7
IIIc
IIIb
10
Binds FGF
Adult
NCAM
FGFR-2
Smith and Valcárcel, TIBS 2000
Human Fibronectin
3'
5'
ED B
(ED II)
RGD
ED A
(ED I)
IIICS
NH2
COOH
91 aa
90 aa
120 aa
89 aa
95 aa
64 aa
0 aa
Kornblihtt et al., FASEB J. 1996
Drosophila DSCAM gene: 38,016 different variants
Zipursky lab: Schmucker et al. Cell 2000
El splicing alternativo parece ser la
causa de la gran complejidad de los
vertebrados (nosotros)
Gusano Caenorhabditis elegans
Invertebrado microscópico de 1 mm de largo formado por 1000 células
19.000 genes en cada célula
Fuente: http://www.bio.unc.edu/faculty/goldstein/lab/movies.html
Homo sapiens sapiens
Vertebrado macroscópico de casi 2 m de largo formado por 1013 células
23.000 genes en cada célula
No somos más complejos porque
tengamos más genes
gusano
genes
humano
19.000 ~ 23.000
splicing alternativo
proteínas
25.000
≠
100.000
Lo que ocurre es que nuestros genes pueden
generar muchas más proteínas que los del
gusano
First come, first served (where first served means first excised)
Fast elongation/no pauses
Strong 3’SS
Weak 3’SS
Exclusion
pol II
U2AF
35
U1 U2AF
65 SF1
Slow elongation/ with pauses
Weak 3’SS
Strong 3’SS
Inclusion
pol II
pol II
U1
U2AF
35
U2AF
65
SF1
U1
U2AF
35
U2AF
65
SF1
Modulation of pol II intrinsic activity
(e.g. CTD phosphorylation, association to elongation factors)
changes in pol II elongation rate
(kinetic coupling)
Changes in the template
chromatin structure that limit or
facilitate elongation
UV light and alternative splicing
Fast elongation
Slow elongation
Pol II
Cap
Pol II
Cap
Pre-mRNA
Pre-mRNA
Pol II
Cap
Pre-mRNA
UV IRRADIATION
Pol II
Cap
Pre-mRNA
mRNA Cap
(A)n
Skipping
mRNA Cap
(A)n
Inclusion
Muñoz et al., Cell 2009; Muñoz et al. TiBS 2010
Modulation of pol II intrinsic activity
(e.g. CTD phosphorylation, association to elongation factors)
changes in pol II elongation rate
(kinetic coupling)
Changes in the template
chromatin structure that limit or
facilitate elongation
Chromatin and alternative splicing
Pol II
Trichostatin A
(TSA)
REPLICATION
Pol
II
Kadener et al., EMBO J. 2001
Nogués et al., J. Biol. Chem. 2002
Neuron depolarization
TSA
H3K9ac
Neuron differentiation
H3K9ac
H3K9ac
Pol II
H3K9ac H3K9ac
H3K9me H3K9me
H3K9me
Pol II
H3K9ac
H3K9me H3K9me
La secuenciación de decenas de
genomas confirmó la evolución y la
selección natural de las especies
Gracias!