1
Download SNP - USC
Document related concepts
no text concepts found
Transcript
SNP Bioinformatics SNPs [email protected] miércoles 15 de julio de 2009 The USC Genomic Medicine Group SNPs CeGen Santiago node / Genomic Medicine! GMX! Forensic Genetics Forensic Genetics! SNPfor ID miércoles 15 de julio de 2009 FPGMX! The USC Genomic Medicine Group SNPs CeGen Santiago node / Genomic Medicine! GMX! Forensic Genetics Forensic Genetics! SNPfor ID miércoles 15 de julio de 2009 FPGMX! The USC Genomic Medicine Group SNPs CeGen Santiago node / Genomic Medicine! GMX! Forensic Genetics Forensic Genetics! SNPfor ID miércoles 15 de julio de 2009 FPGMX! The USC Genomic Medicine Group SNPs CeGen Santiago node / Genomic Medicine! GMX! Forensic Genetics Forensic Genetics! SNPfor ID miércoles 15 de julio de 2009 FPGMX! Simple guides to SNP searching SNPs miércoles 15 de julio de 2009 a SNP is a single nucleotide polymorphism miércoles 15 de julio de 2009 a SNP is a single nucleotide polymorphism miércoles 15 de julio de 2009 a SNP is a single nucleotide polymorphism Single nucleotide poymorphism or simple nucleotide poymorphism ?! simple nucleotide polymorphisms! ATCGGCTAGCTGCTCCGCTGACTCGTCGTCGGGCGTTAC transitions! transversions insertion deletion! ATTGACTATCTGATCCGCATGACCGTCAGATGTCGGGCC . base substitutions! ! single nucleotide polymorphisms! miércoles 15 de julio de 2009 single base indels ! small multi-base indels! H sapiens ancestral G GTAAGTC CCATAGTG A derived Pan troglodytes GTCAGTCGCCATAGTG Single nucleotide poymorphism or simple nucleotide poymorphism ?! simple nucleotide polymorphisms! ATCGGCTAGCTGCTCCGCTGACTCGTCGTCGGGCGTTAC transitions! transversions insertion deletion! ATTGACTATCTGATCCGCATGACCGTCAGATGTCGGGCC . base substitutions! ! single nucleotide polymorphisms! miércoles 15 de julio de 2009 single base indels ! small multi-base indels! 15 million SNPs available SNPs miércoles 15 de julio de 2009 15 million SNPs available NCBI SNPs dbSNP The SNP consortium! Celera & AOD! HapMap! miércoles 15 de julio de 2009 SNPs occur regularly SNPs 3.3 gigabases of genome! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 1.42 million SNPs! 1 SNP / 2,300 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 3 million! 1 SNP / 1,000 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 10 million! miércoles 15 de julio de 2009 1 SNP / 330 bp! SNPs occur regularly SNPs 3.3 gigabases of genome! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 1.42 million SNPs! 1 SNP / 2,300 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 3 million! 1 SNP / 1,000 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 10 million! miércoles 15 de julio de 2009 1 SNP / 330 bp! SNPs occur regularly SNPs 3.3 gigabases of genome! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 1.42 million SNPs! 1 SNP / 2,300 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 3 million! 1 SNP / 1,000 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 10 million! miércoles 15 de julio de 2009 1 SNP / 330 bp! SNPs occur regularly SNPs 3.3 gigabases of genome! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 1.42 million SNPs! 1 SNP / 2,300 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 3 million! 1 SNP / 1,000 bp! ACAGTCTGAC C GTACTAGTTA ACAGTCTGAC T GTACTAGTTA! 10 million! HapMap ENCODE! miércoles 15 de julio de 2009 1 SNP / 330 bp! 1 SNP / 279bp! SNPs are regular and dense making perfect genome markers miércoles 15 de julio de 2009 SNPs SNPs are regular and dense making perfect genome markers miércoles 15 de julio de 2009 SNPs SNP density is consistent across the genome but gene density is not miércoles 15 de julio de 2009 constitutive heterochromatin is SNP free! facultative heterochromatin has even SNPs & uneven genes! 13 miércoles 15 de julio de 2009 13 21 21 SNP density ‘peaks’ can signify functionality Chr 6 MHC [major histocompatibility complex] region shown where hyper-variability infers a flexible immune response and recognition of self vs non-self 6 miércoles 15 de julio de 2009 SNP density ‘peaks’ can signify functionality Chr 6 MHC [major histocompatibility complex] region shown where hyper-variability infers a flexible immune response and recognition of self vs non-self 6 miércoles 15 de julio de 2009 SNP density ‘peaks’ can signify functionality Chr 6 MHC [major histocompatibility complex] region shown where hyper-variability infers a flexible immune response and recognition of self vs non-self 6 miércoles 15 de julio de 2009 How SNPs are created miércoles 15 de julio de 2009 How SNPs are created 350000 SNPs by substitution (chromosome 1) 300000 250000 200000 150000 100000 50000 0 AG miércoles 15 de julio de 2009 CT AC GT CG AT How SNPs are created 350000 SNPs by substitution (chromosome 1) 300000 250000 methylation 200000 150000 thymine! cytosine! 5-methylcytosine! 100000 50000 0 AG miércoles 15 de julio de 2009 CT AC GT CG AT How SNPs are created 350000 SNPs by substitution (chromosome 1) 300000 250000 methylation 200000 150000 thymine! cytosine! 5-methylcytosine! 100000 50000 0 AG miércoles 15 de julio de 2009 CT AC GT CG AT CG GC C* G GC CT SNP created! TG AC TG GC CG GC C methylation creates an unstable base CG GC CG G C* AG SNP created! CG GT CA GT CG GC miércoles 15 de julio de 2009 SNPs Types of SNP SNPs dbSNP miércoles 15 de julio de 2009 Types of SNP SNPs gene! transcription! pre-mRNA transcript! dbSNP splicing! functional mRNA! translation! miércoles 15 de julio de 2009 Types of SNP SNPs gene! transcription! non-synonymous synonymous pre-mRNA transcript! dbSNP splicing! functional mRNA! translation! miércoles 15 de julio de 2009 SNPs ATM: 146,267bp 723 SNPs [1/202bp] 63 exons MC1R: 2,358bp 54 SNPs [1/44bp] 1 exon miércoles 15 de julio de 2009 Types of SNP promotor SNP gene! inter-genic SNP transcription! pre-mRNA transcript! splicing! non-synonymous coding functional mRNA! promotor splice-site miércoles 15 de julio de 2009 ! translation! ! Eye Colour is dictated by a promotor in another gene miércoles 15 de julio de 2009 SNPs Eye Colour is dictated by a promotor in another gene miércoles 15 de julio de 2009 SNPs Eye Colour is dictated by a promotor in another gene miércoles 15 de julio de 2009 SNPs Eye Colour is dictated by a promotor in another gene GG rs12913832 AG miércoles 15 de julio de 2009 AG AA SNPs Eye Colour is dictated by a promotor in another gene GG rs12913832 AG miércoles 15 de julio de 2009 AG AA SNPs Types of SNP ! SNPs promotor SNP gene! inter-genic SNP transcription! pre-mRNA transcript! splicing! non-synonymous coding functional mRNA! promotor splice-site miércoles 15 de julio de 2009 translation! ! Types of SNP ! SNPs promotor SNP gene! inter-genic SNP transcription! pre-mRNA transcript! splicing! non-synonymous coding functional mRNA! promotor splice-site miércoles 15 de julio de 2009 translation! ! Types of SNP ! SNPs promotor SNP gene! inter-genic SNP transcription! pre-mRNA transcript! splicing! non-synonymous coding functional mRNA! promotor splice-site miércoles 15 de julio de 2009 translation! ! Types of SNP ! SNPs promotor SNP gene! inter-genic SNP transcription! pre-mRNA transcript! splicing! non-synonymous coding functional mRNA! Linkage disequilibrium LD promotor splice-site miércoles 15 de julio de 2009 translation! ! Recombination in the genome miércoles 15 de julio de 2009 SNPs Recombination in the genome miércoles 15 de julio de 2009 SNPs Recombination in the genome recombination in females miércoles 15 de julio de 2009 SNPs Recombination in the genome recombination in females miércoles 15 de julio de 2009 no recombination haplotypic loci SNPs Recombination in the genome SNPs High LD! Low LD! recombination in females miércoles 15 de julio de 2009 no recombination haplotypic loci LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 LD or haplotype blocks SNPs If haplotype diversity is low in each block a few SNPs can define all the block variability and provide tags for the presence of a gene variant in linkage miércoles 15 de julio de 2009 http://www.hapmap.org/downloads/nature02168.pdf! miércoles 15 de julio de 2009 http://www.hapmap.org/downloads/nature02168.pdf! miércoles 15 de julio de 2009 http://www.hapmap.org/downloads/nature02168.pdf! miércoles 15 de julio de 2009 LD block structure and tag SNPs SNPs recombination hotspots SNPs LD blocks genes miércoles 15 de julio de 2009 LD block structure and tag SNPs SNPs recombination hotspots SNPs LD blocks genes tag SNPs miércoles 15 de julio de 2009 LD block structure and tag SNPs SNPs recombination hotspots SNPs LD blocks genes tag SNPs miércoles 15 de julio de 2009 LD block structure and tag SNPs SNPs recombination hotspots SNPs LD blocks genes tag SNPs non-synonymous coding promotor splice-site miércoles 15 de julio de 2009 LD block structure and tag SNPs SNPs recombination hotspots SNPs LD blocks genes tag SNPs non-synonymous coding promotor splice-site miércoles 15 de julio de 2009 tag SNPs LD block structure and tag SNPs SNPs recombination hotspots SNPs LD blocks genes tag SNPs non-synonymous coding promotor splice-site miércoles 15 de julio de 2009 tag SNPs CNV (copy number variation) CNVs: four models of effect SNPs miércoles 15 de julio de 2009 Simple association studies of genes are now extended to the whole genome - unbiased approach Association study designs: ! SNPs Affymetrix! Illumina! 60-100! Sequenom! SNPlex! 400-1000 each! miércoles 15 de julio de 2009 The Affymetrix WGS system miércoles 15 de julio de 2009 SNPs Hybridization and signal generation ‘soup’ of DNA fragments from sample each with fluorescent tags if complimentary base in middle is correct DNA fragment hybridizes with DNA on GeneChip array miércoles 15 de julio de 2009 SNPs Hybridization and signal generation SNPs ‘soup’ of DNA fragments from sample each with fluorescent tags 650k - 2M SNPs on a single chip if complimentary base in middle is correct DNA fragment hybridizes with DNA on GeneChip array miércoles 15 de julio de 2009 Hybridization and signal generation SNPs ‘soup’ of DNA fragments from sample each with fluorescent tags 650k - 2M SNPs on a single chip Illumina or Affymetrix if complimentary base in middle is correct DNA fragment hybridizes with DNA on GeneChip array miércoles 15 de julio de 2009 Peaks of association P values then highlight interesting areas - but the probabilities are not strong SNPs Broad T2 Diabetes WGS miércoles 15 de julio de 2009 Whole Genome Scans miércoles 15 de julio de 2009 SNPs Whole Genome Scans SNPs 650k - 2M SNPs on a single chip miércoles 15 de julio de 2009 Whole Genome Scans SNPs 650k - 2M SNPs on a single chip Illumina or Affymetrix miércoles 15 de julio de 2009 Whole Genome Scans SNPs 650k - 2M SNPs on a single chip Illumina or Affymetrix USC: 16 chips in four days miércoles 15 de julio de 2009 Signal variation between runs is a major problem SNPs If DNA is prepared separately for case and control samples or in different labs signal consistency can create false genotype patterns Here heterozygote case data may be clustered with homozygous A miércoles 15 de julio de 2009 Imputing data - practice unimputed SNP genotypes imputed SNP genotypes TCF7L2 miércoles 15 de julio de 2009 SNPs Imputation rescues data rather than creates it miércoles 15 de julio de 2009 SNPs SNPs in forensic analysis Identification as a supplement to STRs Ancestry Phenotyping - pigmentation (SHEP) miércoles 15 de julio de 2009 SNPs SNaPshot is system of choice for forensic SNP typing Non-human pigtails T A C G 1.! Extension of locus specific primers with allele specific ddNTPs 2.! Electrophoresis of labelled fragments miércoles 15 de julio de 2009 SNPs SNP G - ddNTP A - ddNTP T - ddNTP C - ddNTP Highly degraded DNA miércoles 15 de julio de 2009 SNP casework application 1 Highly degraded DNA miércoles 15 de julio de 2009 SNP casework application 1 Highly degraded DNA • SNP casework application 1 Fragmented and charred skeleton uncovered by major forest fire in 2006 miércoles 15 de julio de 2009 Highly degraded DNA • SNP casework application 1 Fragmented and charred skeleton uncovered by major forest fire in 2006 All available markers used to identify remains by matching to a daughter • miércoles 15 de julio de 2009 Highly degraded DNA • SNP casework application 1 Fragmented and charred skeleton uncovered by major forest fire in 2006 All available markers used to identify remains by matching to a daughter • miércoles 15 de julio de 2009 • STRs • mini-STRs • mtDNA • SNPs STRs SNPs 23plex! 6plex! 29plex! 8plex! 34plex! 3plex! miércoles 15 de julio de 2009 The CEPH diversity panel SNPs 377 STRs 34 SNPs miércoles 15 de julio de 2009 The CEPH diversity panel SNPs 377 STRs 34 SNPs miércoles 15 de julio de 2009 The CEPH diversity panel SNPs 377 STRs 34 SNPs miércoles 15 de julio de 2009 Afr 123/123 Eur 155/160 Asn 237/237 miércoles 15 de julio de 2009 Afr 123/123 Eur 155/160 Asn 237/237 miércoles 15 de julio de 2009 Afr 123/123 Eur 155/160 Asn 237/237 miércoles 15 de julio de 2009 Afr 123/123 Eur 155/160 Asn 237/237 miércoles 15 de julio de 2009 Establishing ancestry miércoles 15 de julio de 2009 SNP casework application 2 Establishing ancestry miércoles 15 de julio de 2009 SNP casework application 2 Establishing ancestry miércoles 15 de julio de 2009 SNP casework application 2 Establishing ancestry SNP casework application 2 TTCCCCTTGGAATTCTNNTTAAAATTCCAACTAACCAAGGCCAGCCGTAATTGGATAACGTTAACCNN miércoles 15 de julio de 2009 Establishing ancestry SNP casework application 2 32 SNPs TTCCCCTTGGAATTCTNNTTAAAATTCCAACTAACCAAGGCCAGCCGTAATTGGATAACGTTAACCNN miércoles 15 de julio de 2009 Establishing ancestry SNP casework application 2 32 SNPs TTCCCCTTGGAATTCTNNTTAAAATTCCAACTAACCAAGGCCAGCCGTAATTGGATAACGTTAACCNN 3,137,090,832,719 x more likely EUR than ASN miércoles 15 de julio de 2009 Establishing ancestry SNP casework application 2 32 SNPs TTCCCCTTGGAATTCTNNTTAAAATTCCAACTAACCAAGGCCAGCCGTAATTGGATAACGTTAACCNN 3,137,090,832,719 x more likely EUR than ASN 18,042,414,120,482,412,544 x more likely EUR than AFR miércoles 15 de julio de 2009 Melanocortin 1 receptor MC1R variant detection is the only current phenotyping test in routine use miércoles 15 de julio de 2009 Melanocortin 1 receptor MC1R variant detection is the only current phenotyping 8% test11% in routine use 5% miércoles 15 de julio de 2009 Melanocortin 1 receptor MC1R variant detection is the only current phenotyping 8% test11% in routine use 5% miércoles 15 de julio de 2009 Melanocortin 1 receptor MC1R variant detection is the only current phenotyping 8% test11% in routine use 60 151 160 5% miércoles 15 de julio de 2009 294 Melanocortin 1 receptor MC1R variant detection is the only current phenotyping 8% test11% in routine use 60 151 160 5% 0.42 miércoles 15 de julio de 2009 0.27 294 0.07 Melanocortin 1 receptor MC1R variant detection is the only current phenotyping 8% test11% in routine use 60 151 160 5% 0.42 miércoles 15 de julio de 2009 0.27 294 0.07 Genotype Red hair Other hair wt / wt 0 35 wt / var 4 34 var1 / var2 32 2 var / var 14 0 MC1R SNP typing miércoles 15 de julio de 2009 SNP casework application 3 MC1R SNP typing miércoles 15 de julio de 2009 SNP casework application 3 MC1R SNP typing SNP casework application 3 Contract killing in Glasgow of a man in car park using a high velocity rifle • miércoles 15 de julio de 2009 MC1R SNP typing SNP casework application 3 Contract killing in Glasgow of a man in car park using a high velocity rifle • miércoles 15 de julio de 2009 MC1R SNP typing SNP casework application 3 Contract killing in Glasgow of a man in car park using a high velocity rifle • Ballistic angles indicated a particular window on 14th floor of tower block • miércoles 15 de julio de 2009 MC1R SNP typing SNP casework application 3 Contract killing in Glasgow of a man in car park using a high velocity rifle • Ballistic angles indicated a particular window on 14th floor of tower block • Eye witness reports of a red-haired man hurrying away from tower block • miércoles 15 de julio de 2009 MC1R SNP typing SNP casework application 3 Contract killing in Glasgow of a man in car park using a high velocity rifle • Ballistic angles indicated a particular window on 14th floor of tower block • Eye witness reports of a red-haired man hurrying away from tower block • Multiple contact trace STR profiles from 14th floor flat gave a single case of a compound heterozygote (var1/var2) MC1R type • miércoles 15 de julio de 2009 MC1R SNP typing SNP casework application 3 Contract killing in Glasgow of a man in car park using a high velocity rifle • Ballistic angles indicated a particular window on 14th floor of tower block • Eye witness reports of a red-haired man hurrying away from tower block • Multiple contact trace STR profiles from 14th floor flat gave a single case of a compound heterozygote (var1/var2) MC1R type • Database hit from STR profile of MC1R variant led to suspect • miércoles 15 de julio de 2009 SNPs miércoles 15 de julio de 2009 SNPs miércoles 15 de julio de 2009 SNPs 4 miércoles 15 de julio de 2009 SNPs 4 miércoles 15 de julio de 2009 SNPs 4 miércoles 15 de julio de 2009 SNP Databases Markers (STRs and SNPs) Genes Phenotypes Populations miércoles 15 de julio de 2009 SNPs SNP Databases Markers (STRs and SNPs) Genes Phenotypes Populations miércoles 15 de julio de 2009 SNPs SNPs miércoles 15 de julio de 2009
Related documents