Download a comprehensive approach in identifying sources of contamination

A COMPREHENSIVE APPROACH IN IDENTIFYING SOURCES
OF CONTAMINATION, UNDERSTANDING WATER QUALITY PERCEPTION,
AND TRANSLATING INFORMATION THROUGH COMMUNITY OUTREACH IN
THE UPPER GILA WATERSHED IN CLIFTON, ARIZONA
by
Berenise Rivera
____________________________
A Dissertation Submitted to the Faculty of the
DEPARTMENT OF SOIL, WATER AND ENVIRONMENTAL SCIENCE
In Partial Fulfillment of the Requirements
For the Degree of
DOCTOR OF PHILOSOPHY
In the Graduate College
THE UNIVERSITY OF ARIZONA
2014
2
THE UNIVERSITY OF ARIZONA
GRADUATE COLLEGE
As members of the Dissertation Committee, we certify that we have read the dissertation
prepared by Berenise Rivera, titled A Comprehensive Approach in Identifying Sources of
Contamination, Understanding Water Quality Perception, and Translating Information
through Community Outreach in the Upper Gila Watershed in Clifton, AZ and
recommend that it be accepted as fulfilling the dissertation requirement for the Degree of
Doctor of Philosophy.
_______________________________________________________________________ Date:
April 14, 2014
Dr. Channah Rock
_______________________________________________________________________ Date:
April 14, 2014
Dr. Raina Maier
_______________________________________________________________________ Date:
April 14, 2014
Dr. Charles P. Gerba
Final approval and acceptance of this dissertation is contingent upon the candidate’s
submission of the final copies of the dissertation to the Graduate College.
I hereby certify that I have read this dissertation prepared under my direction and
recommend that it be accepted as fulfilling the dissertation requirement.
________________________________________________ Date: April 14, 2014
Dissertation Director: Dr. Channah Rock
3
STATEMENT BY AUTHOR
This dissertation has been submitted in partial fulfillment of the requirements for
an advanced degree at the University of Arizona and is deposited in the University
Library to be made available to borrowers under rules of the Library.
Brief quotations from this dissertation are allowable without special permission,
provided that an accurate acknowledgement of the source is made. Requests for
permission for extended quotation from or reproduction of this manuscript in whole or in
part may be granted by the head of the major department or the Dean of the Graduate
College when in his or her judgment the proposed use of the material is in the interests of
scholarship. In all other instances, however, permission must be obtained from the
author.
SIGNED: Berenise Rivera
4
ACKNOWLEDGEMENTS
I would like to thank all the people that have played a role in my educational and career
decisions. I would like to extend my gratitude to Dr. Rock for giving me the opportunity
to pursue my passion, encouragement, and advice.
5
DEDICATION
I would like to dedicate this to my mother Trinidad Estela. Mamá muchas gracias por tu
amor incondicional, apoyo, y palabras de sabiduría que me ayudaron a sobresalir. Me
distes las fuerzas para terminar y tanto yo como usted lo hemos logrado.
To my husband Shawn, who has been very supportive from the day we met. Thank you
for all your unconditional love, support, and encouragement.
To all whom believed in me, inspired me and provided words of encouragement.
6
TABLE OF CONTENTS
ABTRACT……………………………………………………………………………….11
CHAPTER 1: INTRODUCTION……………………………………………………….13
CHAPTER 2: PRESENT STUDY……………………………………………………....24
REFERENCES ………………………………………………………………………… 25
CHAPTER 3: DISSERTATION FORMAT…………………………………………….28
APPENDIX A: USE OF BACTEROIDES MICROBIAL SOURCE TRACKING IN THE
SAN FRANCISCO RIVER, ARIZONA………………………………………………..29
Abstract…………………………………………………………………………..30
Introduction……………………………………………………………………....31
Microbial Detection Methods……………………………………………………34
Molecular Methods………………………………………………………………35
Results and Discussion...…………………………………………………………40
Conclusions………………………………………………………………………44
References………………………………………………………………………..47
APPENDIX B: USE OF SURVEY METHODS TO ENHANCE WATERSHED
EDUCATION OF MINORITY POPULATIONS IN CLIFTON, AZ………………….57
Abstract…………………………………………………………………………..58
Introduction……………………………………………………………………...59
Background……………………………………………………………………....61
Materials and Methods…………………………………………………………..62
Results and Discussion…………………………………………………………...63
Challenges and Recommendations……………………………………………....72
Conclusions……………………………………………………………………....73
References…………………………………………………………………….....76
APPENDIX C: MICROBIAL SOURCE TRACKING: WATERSHED
CHARACTERIZATION AND SOURCE IDENTIFICATION .……………………….78
Water Quality and Fecal Contamination………………………………………...78
Fecal Coliform and Escherichia coli…………………………………………….79
What is Microbial Source Tracking?..…………………………………………...82
What MST Methods are currently being used? …………………………………83
What is Bacteroides? ……………………………………………………………85
7
TABLE OF CONTENTS-CONTINUED
MST Supporting Watershed Characterization and Source Identification in
Arizona………………………………………………………………………….88
References………………………………………………………………………91
APPENDIX D: SEGUIMIENTO DE ORIGEN MICROBIANO: CARACTERIZACION
DE CUENCAS E IDENTIFICACION DE ORIGEN………………………………....104
La Calidad del Agua y Contaminación fecal…………………………………...104
Coliformes fecales y Escherichia coli ................................................................105
¿Qué es el Seguimiento de Origen Microbiano? ……………………………....108
¿Qué métodos del SFM se están utilizando en la actualidad? ………………....110
¿Qué es Bacteroides? …………………………………………………………..112
SFM Apoya Caracterización de Cuencas e identificación de fuentes en
Arizona………………………………………………………………………….115
Referencias……………………………………………………………………...118
APPENDIX E: WATER QUALITY, E. COLI AND YOUR HEALTH………………131
What is Water Quality?.………………………………………………………...131
What is E. coli? ………………………………………………………………...131
E. coli in our Water……………………………………………………………..133
How do we make sure our water is safe?……………………………………….135
What can you do in your community to protect water quality………………….137
References……………………………………………………………………....139
APPENDIX F: LA CALIDAD DEL AGUA, E. COLI Y SU SALUD………………..144
¿Qué es la calidad del Agua?...............................................................................144
¿Qué es E. coli?....................................................................................................144
E. coli en el agua………………………………………………………………..146
¿Cómo nos aseguramos de que nuestra agua es segura?......................................150
¿Qué puede hacer en su comunidad para proteger la calidad del agua?.............153
Referencias……………………………………………………………………...154
APPENDIX G: RAW DATA FOR APPENDIX A……………………………………159
8
LIST OF TABLES
APPENDIX A: USE OF BACTEROIDES MICROBIAL SOURCE TRACKING IN THE
SAN FRANCISCO RIVER, ARIZONA
Table 1. PCR Primers and Reactions Conditions………………………………..50
Table 2. Quantitative PCR Real-Time Conditions………………………………51
Table 3. The Correlation (p-values) between E. coli concentrations and
Bacteroides molecular markers for each site…………………………...56
APPENDIX B: USE OF SURVEY METHODS TO ENHANCE WATERSHED
EDUCATION OF MINORITY POPULATIONS IN CLIFTON, AZ
Table 1. Survey Topics…………………………………………………………..63
Table 2. The distribution of respondents regarding poor water quality…………70
APPENDIX C: MICROBIAL SOURCE TRACKING: WATERSHED
CHARACTERIZATION AND SOURCE IDENTIFICATION
Table 1. Common Types of MST Methods ……………………………………..94
Table 2. Commonly Used Terms ………………………………………………..95
APPENDIX D: SEGUIMIENTO DE ORIGEN MICROBIANO: CARACTERIZACION
DE CUENCAS E IDENTIFICACION DE ORIGEN
Tabla 1. Tipos comunes de métodos de seguimiento de fuente microbiana
(SFM)……………………………………………………………..........121
Tabla 2. Términos de uso general………………………………………………122
APPENDIX E: WATER QUALITY, E. COLI AND YOUR HEALTH
Table 1. Harmful strains of E. coli……………………………………………..142
Table 2. Level of E. coli permitted for Different Types of Water……………..143
APPENDIX F: LA CALIDAD DEL AGUA, E. COLI Y SU SALUD
Tabla 1. Cepas dañinas de E. coli………………………………………………157
Tabla 2. Niveles de E. coli permitidos para los diferentes tipos de agua………158
APPENDIX G: RAW DATA FOR APPENDIX
Table 1. Raw Data from the San Francisco River……………………………...159
9
LIST OF FIGURES
APPENDIX A: USE OF BACTEROIDES MICROBIAL SOURCE TRACKING IN THE
SAN FRANCISCO RIVER, ARIZONA
Figure 1. San Francisco River Watershed Sampling Sites……………………….49
Figure 2. Average E. coli Concentrations Per Location (n=70)………………….52
Figure 3. Boxplot of Allbac concentrations of the San Francisco River………...53
Figure 4. Boxplot of HF183 concentrations of the San Francisco River...............54
Figure 5. Boxplot of CowM2 concentrations of the San Francisco River……….55
APPENDIX B: USE OF SURVEY METHODS TO ENHANCE WATERSHED
EDUCATION OF MINORITY POPULATIONS IN CLIFTON, AZ
Figure 1. Water Quality Rating of the local river………………………………..64
Figure 2. Respondents’ attitudes (%) of general water quality in the San
Francisco River………………………………………………………..67
Figure 3. Respondents’ opinions (%) on how much of a problem the following
sources are in the San Francisco River………………………………..69
Figure 4. Ways used by residents (%) to get information about water quality….72
APPENDIX C: MICROBIAL SOURCE TRACKING: WATERSHED
CHARACTERIZATION AND SOURCE IDENTIFICATION
Figure 1. Waterborne transmission of pathogens.……………………………….96
Figure 2. Relationship between indicators and pathogens……………………….97
Figure 3. Visualization of a fecal contaminated water sample; cells fluorescing
blue indicate the presence of E. coli in the water…...…………………98
Figure 4. PhD student, Berenise Rivera, demonstrates sterile technique while
assaying water samples for fecal bacteria……………………………..99
Figure 5. DNA Extraction/Concentration………………………………………100
Figure 6. Volunteer water quality monitoring team receives training from UA
Cooperative Extension……………………………………………….101
Figure 7. Volunteer water quality monitoring in the Santa Cruz River, AZ…...102
Figure 8. Environmental water samples collected in the field………………….103
APPENDIX D: SEGUIMIENTO DE ORIGEN MICROBIANO: CARACTERIZACION
DE CUENCAS E IDENTIFICACION DE ORIGEN
Figura 1. Transmisión de agentes patógenos a través del agua…………………123
Figura 2. Relación entre los indicadores y patógenos…………………………..124
Figura 3. Visualización de una muestra de agua contaminada con material
fecal Células azules fluorescentes indican la presencia de E. coli en
el agua………………………………………………………………...125
10
LIST OF FIGURES-CONTINUED
Figura 4. Estudiante de doctorado, Berenise Rivera, demuestra una técnica
estéril mientras analiza muestras de agua para las bacterias fecales….126
Figura 5. Extracción/Concentración de ADN………………………………….127
Figura 6. Voluntarios del equipo de monitoreo de calidad del agua reciben
entrenamiento organizado por personal de Extensión Cooperativa
de la UA……………………………………………………………....128
Figura 7. Voluntario de monitoreo de calidad del agua en el Río Santa Cruz,
Arizona……………………………………………………………….129
Figura 8. Muestras de agua ambientales colectadas en el campo………………130
APPENDIX E: WATER QUALITY, E. COLI AND YOUR HEALTH
Figure 1. E. coli…………………………………………………………………141
APPENDIX F: LA CALIDAD DEL AGUA, E. COLI Y SU SALUD
Figura 1. E. coli…………………………………………………………………156
11
ABSTRACT
As of 2010, there are approximately twenty one surface water locations classified
as impaired for Escherichia coli (E. coli) contamination in the State of Arizona. Of note
is the San Francisco River (SFR) which is currently listed on the US EPA 303d list of
impaired waters due to E. coli bacteria present at higher concentrations than the US EPA
standards for partial- and full-body contact. In 2010-2011 surface water samples were
collected at sites within the impaired region to monitor E. coli and areas known for heavy
recreational uses. Of 70 samples collected over 1 year, 81% were positive for universal
Bacteroides marker (Allbac). Of the 57 Allbac-positive samples, 68% show contributions
of the human-specific marker and 60% were positive for bovine-specific marker. While
28% of the total samples assayed showed elevated levels of E. coli (>235 MPN/100mL),
there were minimal significant correlations between Bacteroides and generic E. coli
across all samples.
While this information is significant, past research has suggested that successfully
distinguishing the sources of fecal contamination will not alone reduce or eliminate
disease associated with contaminated water unless these investigations are coupled with
public outreach and education. With this in mind a survey was developed to gather
information about water quality perceptions, water use, peoples’ attitudes, knowledge,
and behaviors related to the water resources in Clifton, AZ. Survey questions consisted of
multiple choice and Likert scales questions and were provided in both English and
Spanish and were conducted during the summer of 2012 and winter of 2013. A total of
12
150 surveys were deployed with 38 surveys completed for a response rate of 25%. Our
study findings indicate mixed attitudes on water quality with 80% reporting the SFR has
poor water quality for drinking and 39% agree the SFR has poor water quality for
swimming. Yet, 84% consider the river safe enough for picnics and activities near the
water. Also, it was interesting to note participants’ opinions regarding consequences of
poor water quality with 66% of respondents indicating that they are concerned with poor
water quality and their health. Clifton is a very tight knit community so it was not
unexpected that the majority of the respondents (61%) get water quality information by
having conversations with other people and 68% from newspapers, factsheets and
brochures.
Based on the survey responses, our team worked to develop two peer reviewed
Extension publications entitled; Microbial Source Tracking: Watershed Characterization
and Source Identification (Arizona Cooperative Extension, #AZ1547) and Water Quality,
E. coli, and Your Health (#AZ1624). Publications have been developed in both English
and Spanish and will be part of future outreach to this and other Arizona communities. It
is our goal that these survey findings can be used to better tailor outputs appropriate for
the targeted audience, namely the local Hispanic population. These results are important
because they add to understanding perceptions of water quality and health risks in this
rural community; and can lend towards enhanced outreach practices in other similar
communities.
13
CHAPTER 1: INTRODUCTION
Indicator Bacteria
The use of bacteria as indicators for water quality dates back as far as 1880
(Ashbolt et al., 2001). Today, microbial indicators help determine the potential presence
or absence of pathogens, therefore minimizing possible health risks related with diseasecausing bacteria (Scott et al, 2002). In polluted water, coliform bacteria are found in
densities roughly proportional to degree of fecal pollution. E. coli are fecal coliforms that
have been used as microbial indicators to show presence or absence in water systems
(Parveen et al., 2001). In addition, E. coli can be easily distinguished from other members
of the fecal coliform group and is more likely to indicate fecal pollution. However,
numerous warm-blooded animals discharge fecal coliforms; therefore, humans are not
solely responsible for fecal coliforms found in water (Buchan et al., 2001, Field et al,
2007). Consequently, fecal coliform presence in water is not explicit to human sources of
pollution. There are certain microbial populations associated with the intestines of
particular animal types. Some factors influence the composition of the microbiota of the
gastrointestinal tract of host species. Some of these factors are constrained by the host
anatomical and physiological conditions such as diet, microbe-microbe interactions and
host-microbe interactions.
Several traditional methods have been used to determine sources of pollution:
e.g., antibiotic resistance patterns, phage susceptibility, or fecal coliforms to fecal
streptococci (FC/FS ratios). For the FC/FS ratio method, a ratio greater than or equal to
4.0 would indicate human fecal pollution, while a ratio below 7.0 is linked with animal
14
fecal pollution (Scott et al., 2002). These ratios vary on the diets of individuals and
environmental factors such as temperature and ultra-violet light, which decrease the
survival of coliforms and streptococci bacteria. As a result, the use of FC/FS has
decreased in the last twenty years (Simpson et al., 2002). There have been several
attempts to differentiate between human and nonhuman sources of fecal coliforms in a
body of water; these attempts have been ineffective; therefore, molecular-based
techniques are under development with the intent to differentiate among the associated
strains of E. coli (Buchan et al., 2001).
Limitations of Indicator Bacteria. Monitoring for all waterborne pathogens in
surface water is currently unfeasible due to plethora of pathogens that are known to be
present in fecal waste (e.g. viruses, bacteria, and protozoa). In addition, to monitor all
pathogens would be time consuming and expensive (Field and Samadpour, 2007).
Existing methods required for concentrating and analyzing pathogens, yet monitoring for
only one or a handful of pathogens may give rise to a false impression of safety if
pathogens other than those being tested are present (Hardwood et al, 2013). Some
limitations of indicator bacteria: First, epidemiology studies were based on exposure to
human fecal contamination, not animal; therefore we don’t know the risk from exposure
to similar levels of animal fecal contamination. Secondly, fecal indicators such as E. coli
and Enterococcus spp. can survive and proliferate in the environment in many
environments (Harwood et al, 2013). Lastly, E. coli and enterococci are not well
correlated with many pathogens and tests do not distinguish the source of fecal
contamination. Despite these limitations, it is a standard practice to monitor fecal
15
indicator bacteria such as total and fecal coliforms, E. coli and fecal enterococci in water
(Field and Samadpour, 2007).
What is Bacteroides?
Bacteroides is a genus of anaerobic fecal bacteria that are abundant in the gut of
mammals. Although Bacteroides is present in feces at higher concentrations than
indicator bacteria, cultivation of these bacteria is difficult and time consuming because
they are anaerobic. Members of the genus Bacteroides form a coherent phylogenetic
cluster within the Cytophaga-Flexibacter-Bacteroides (CFB) phylum. Smith et al 2006
state, the genus Bacteroides falls within the family of Bacteroidaceae of the proposed
Order “Bacteroidales” of the proposed Class “Bacteroidetes”. The taxonomy of
Bacteroides has undergone major reviews but the genus includes Bacteroides fragilis, B.
thetaiotaomicron, B. ovatus, B. uniformis, B. vulgatus, B. distasonis, B. eggerthii, B.
caccae, B. merdae, and B. stercoris just to name a few of the more than 20 identified
species (Smith et al, 2006 and Wexler, 2007). The Bacteroides species are gramnegative, nonspore-forming, bile-resistant, nonmotile, anaerobic rods normally found and
isolated from the gastrointestinal tract (GI-tract) of humans and animals (Smith et al.,
2006 and Wexler, 2007). The human colon has the largest population of bacteria up to
1011 organisms per gram of wet weight and the majority of these organisms are anaerobes
which consist of approximately 25% Bacteroides species (Wexler, 2007). Fecal members
of the Bacteroidales group are plentiful in the feces of warm-blooded animals and
members of this order are host- or group- specific (Field et al., 2005). The Bacteroidales
group comprises a large portion of the normal gut flora of most animals including
16
bovines, and contains subgroups that are closely related to other animal hosts such as
swine, horses, and humans (Shanks et al., 2010).
The large quantity of this bacterium has allowed for host-specific analysis
targeting the Bacteroides gene. Layton et al. (2006) states that bacteria belonging to the
Bacteroides group have been recommended as an alternative fecal indicator to E. coli or
fecal coliforms because they make up a considerable portion of the fecal bacterial
population, have little potential for growth in the environment, and have a high degree of
host specificity that reveal the differences in host digestive systems. The possible sources
of fecal contamination can be arranged into two groups: 1) point sources, which consist
of raw and treated sewage leakage and 2) nonpoint sources, which are agricultural and
natural sources (Okabe et al., 2007). The ability to differentiate between sources of fecal
pollution is essential for the accurate assessment of human health risks associated with
exposure and to ensure waters are safe for human use.
Ecology and Habitat. The Bacteroides species are obligate host-associated
organism commonly found in the gastrointestinal tract of humans and other mammals
(Smith et al, 2006). As members of the hosts’ flora, they play an array of roles that
contribute to normal intestinal physiology and function. Some of these beneficial
functions include polysaccharide breakdown. Polysaccharides comprise the most
abundant biological polymer therefore being the most abundant food source (Wexler,
2007). Carbohydrate fermentation by Bacteroides and other intestinal bacteria result in
the production of a pool of volatile fatty acids that are reabsorbed through the large
17
intestine and utilized by the host as an energy source, providing a significant proportion
of the host’s daily energy requirement. Bacteroides species have the ability to utilize the
nutrients at hand by utilizing simple and complex sugars and polysaccharides for growth.
Another beneficial component is nitrogen cycling. The central features of Bacteroides
nitrogen metabolism relate directly to their dependency on ammonia as the primary
nitrogen source and their inability to utilize amino acids as a sole source of nitrogen. As
stated in Smith et al, 2006, Bacteroides spp. has a variety of enzymes such as glutamate
decarboxylase or deaminases that contribute to this function.
Aside from beneficial functions there are other functions that may be damaging
such as the rapid deconjugation of bile acids or the production of compounds with a high
frequency of containing a mutagen (Smith et al., 2006). Thus it is clear that the
Bacteroides spp. display a range of complex interrelations with their animal hosts. It is
the host-commensal or host-parasite interactions that define this group of organisms
(Smith et al, 2006). Bacteroides depend mainly on temperature and presence of predators,
and can survive for up to six days under oxygen stressed conditions (Field et al., 2004).
Virulence and Pathogenesis. As stated before, all of the Bacteroides species have
the potential to be opportunistic pathogens and capable of causing a disease. Organisms
such as Bacteroides with such a large genome bank at their disposal may simply need to
turn on certain genes to change from friendly commensal to dangerous threat. several
species including B. fragilis are important opportunistic pathogens and the most
frequently isolated organisms from anaerobic infections (Smith et al, 2006). For
18
example, B. fragilis is a minor component of the species present in human gut (generally
<1% of the flora), but it accounts for about 50% of all anaerobes isolated from cases of
intra-abdominal infections, infections of the female genital tract, deep wounds and
bactericimia (Smith et al, 2006). According to Wexler (2007) Bacteroides strains may
have all of these; virulence factors can generally be subdivided into three broad
categories: 1) adherence to tissues which is the initial step in the colonization and
multiplication in a host, 2) protection from the host immune response (such as oxygen
toxicity and phagocytosis), or 3) destruction of tissues.
The need for Microbial Source Tracking?
Total Maximum Daily Load. A Total Maximum Daily Load, or TMDL, is a
calculation of the maximum amount of a pollutant that a water body can receive and still
safely meet water quality standards (EPA, 2013). Under section 303(d) of the Clean
Water Act, states, territories, and authorized tribes are required to develop lists of
impaired waters. These are waters that are too polluted (eg. pH, pathogens, sediments,
and/or organics) or otherwise degraded to meet the water quality standards set by states,
territories, or authorized tribes. Water Quality Standards are the foundation of the water
quality-based pollution control program mandated by the Clean Water Act (EPA, 2013).
Water Quality Standards (Table 1) define the goals for a waterbody by designating its
uses, setting criteria to protect those uses, and establishing provisions such as antidegradation policies to protect waterbodies from pollutants.
19
Purpose
Drinking Water
Surface Water Full-Body Contact
(swimming)
Surface Water Partial-Body Contact
(Fishing, boating, etc…)
Wastewater
(irrigation or discharge)
Level of E. coli
Zero
235 cfu/100 mL
575 cfu/100 mL
< 2.2cfu/100 mL
< 1.0 cfu/100 mL
Table 1. Level of E. coli permitted for Different Types of Water (ADEQ, 2010 and EPA,
2009). CFU= colony forming units
ADEQ and 303d list. The Arizona Department of Environmental Quality (ADEQ)
was established by the Arizona Legislature in 1986. ADEQ’s goal is to preserve and
improve public health, welfare, and the environment in Arizona. Today, ADEQ manages
a variety of programs to bring awareness of the water issues Arizona is currently facing.
Also, ADEQ uses programs to improve the wellbeing and health of Arizona’s citizens by
ensuring water resources meet regulatory standards. This regulatory agency maintains a
303d list of locations that do not meet clean water regulatory standards. The 303d section
requires TMDL be determined for the impaired waters by states, territories, and
authorized tribes with supervision by the US EPA (Simpson et al., 2002). As of 2010,
ADEQ listed twenty one impaired watersheds throughout the state of Arizona on the
303d list due to E. coli presence higher than the US EPA set standards (US EPA, 2008).
This agency works diligently to bring those impaired watersheds up to standards.
Surface water quality standards and public health. Human sources of fecal
pollution represent a serious health risk because of the high likelihood of the existence of
human pathogens. Cattle, swine, and chickens carry pathogens that can be transmitted
20
from animals to humans causing disease; therefore are a high concern. Due to the many
associated health risks the presence E. coli pathogens can pose, entities such as the
USEPA and ADEQ have implemented ways to reduce contact with impaired waters. The
level of E. coli present in surface water will determine the acceptance of partial- or fullbody contact. Levels of E. coli cannot exceed 575 CFU per 100 mL for partial body
contact (PBC) (USEPA, 2009). According to the US EPA, PBC means the human body
coming in contact with surface water used for recreational activities, but not to the point
of full-body submergence (2009). In addition, for full-body contact (FBC) E. coli levels
cannot exceed 235 CFU per 100 mL. FBC means the human body is completely under
water that is used for swimming or other recreational activity (USEPA, 2009). Exposure
to water exceeding FBC levels is a health threat. These national standards correspond to
approximately eight incidences of gastrointestinal illness per 100 swimmers per year (US
EPA 2009).
Numerous epidemiologic studies have been conducted around the world to assess
the relation between recreational water quality and serious health effects including but
not limited to gastrointestinal (GI) infectious diseases, eye infections, skin irritations, ear,
nose, throat infections, and respiratory illness. Such studies have concluded that the rates
of some serious health effects are higher in swimmers when compared to non-swimmers
(Smith et al, 2006; Soller et al., 2010). As mentioned earlier in this paper, Bacteroides
comprise a large portion of bacteria present in the intestinal flora of humans. According
to Smith et al. (2006), Bacteroides generally trigger opportunistic infections that can
happen at any time and damage the integrity of the mucosal wall of the intestine can lead
21
to conditions such gastrointestinal surgery, perforated or gangrenous appendicitis,
perforated ulcer, diverticulitis, trauma and inflammatory bowel disease. Identifying the
sources of fecal pollution allows for the monitoring and regulating of locations
contributing to this contamination.
Community Engagement
Public Perception. Understanding public perception is as important as identifying
the source of contamination in order to address water quality issues and protect public
health. One goal of perception studies is to understand the interactions between people
and physical environments (Cervantes et al., 2008). Although, anyone can be affected by
poor water quality, minority populations may be of particular concern due to
environmental and economic disproportions. These disparities are quite abundant
throughout many minority communities in the United States. Substandard housing,
occupational hazards, poor water quality and inequitable distribution of hazardous waste
sites represent only a few problems that compromise the health of minority populations
(Taylor-Clark et al., 2007). Of particular concern, is that these groups might not associate
their current situation to a potential health risk. There is evidence that for many
environmental risks, significant differences in judgments may be observed for those who
differ in ethnicity, socioeconomic status, or educational level (Vaughan and Nordenstam,
1991). Perceptions of risk are influenced, in part, by characteristic ways in which
situations of uncertainty are framed and interpreted. Because culturally based attitudes
and values can influence general orientation toward risk and uncertainty, it is reasonable
to expect that factors differentiating individuals on the basis of shared experiences,
22
values, and beliefs relevant to risk evaluation will be associated with nonequivalent
perceptions in many situations. Taylor-Clark et. al. state, people’s potential for social
action and participation is influenced by how they perceive a social condition as a
problem and the information that they have to mobilize and act on resolving that
problem. In addition, one of the most important predictors of risk perception is direct and
indirect experience with the risk (Morua et al., 2011; Slovic, 1987). According to Morua
et al., direct experience can provide feedback on the degree of risk along with the success
of specific reduction strategies and is likely to vary by location (2011). People who
perceive a relatively high likelihood of an adverse event in their life location
(community) are more likely to take the necessary steps to reduce that likelihood or
minimize negative impacts (O’Connor et al., 1999; Morua et al., 2011).
Information transfer to the public. The potential for involvement to prevent or
address social problems is hindered if there are barriers to accessing information. Access
to information may shape public perceptions of and actions around environmental health
threats (Taylor-Clark et al., 2007; Viswanath and Emmons, 2006). There is insufficient
work that has focused on the communication barriers around environmental health issues
that minorities face. Hispanics are the largest and fastest growing minority group in the
United States. Unfortunately, Hispanics suffer disproportionate rates of environmentally
related morbidity and mortality when compared with more affluent populations and often
tend to live in environmentally stressed communities in which environmental hazards in
the community are more prevalent (Williams and Florez, 2002). To successfully engage
Hispanic audiences, programs must reflect the cultural traditions, beliefs, and values of
23
the people (Hobbs, 2004; Koss-Chioino and Vargas, 1999). While there is potential for
benefits from campaigns to increase between minorities, carefully conceived campaigns
could serve to reduce communication gaps by targeting appropriate channels and sources
of information, while presenting culturally relevant messages (Taylor-Clark et al., 2007).
In addition, several studies have found that there are different levels of trust in
risk-related information (Morua et al., 2007). Therefore, the sources of information are
very important when trying to relay information to a community and increase public
participation. Some studies suggest that the level of trust individuals have in an agency
can greatly influence their willingness to believe information provided by that agency
(Morua et al., 2007). In the El Paso study conducted by Byrd et al, only a third of
interviewees trusted the information provided by the local health department, while 56%
information on television (1997). According to Williams and Florez, minorities often do
no participate at a high level in various types of policy making (2002). Consequently,
minorities have little impact on policies that may result in environmental inequalities in
their communities. Therefore, presentation of culturally relevant messages may reduce
knowledge gaps, increase participation, and thus facilitate effective actions.
24
CHAPTER 2: PRESENT STUDY
The overall goal of this project is to use microbial source tracking methods to
identify sources of contamination in the Upper Gila Watershed and to close the gap
between scientific research and communities through the development of outreach
“tools” in both English and Spanish and outreach activities aimed at educating the
community about water quality and human health.
Specific objectives:
i) To differentiate between human and other sources of fecal contamination by
targeting 16S rRNA Bacteroides in the Upper Gila Watershed.
ii) Evaluate community perception on water quality of the San Francisco River in
Clifton, Arizona.
iii) Develop educational program outputs or “tools” about water quality that are
culturally appropriate for the Clifton community in both English and Spanish.
25
REFERENCES
Arizona Department of Environmental Quality. 2010 Water Quality. [Online]
http://www.azdeq.gov/environ/water/index.html.
Ashbolt, N. J., Grabow, W., and Snozzi, M. 2001 Indicators of Microbial Water Quality.
[Online] www.who.int/water_sanitation_health/dwq/iwachap13.pdf.
Buchan, A., Alber, M., and Hodson, R. E. 2001 Strain-specific differentiation of
environmental Escherichia coli isolates via denaturing gradient gel electrophoresis
(DGGE) analysis of the 16S-23S intergenetic spacer region. FEMS Microbiol.
Ecol. 35: 313-321.
Byrd, T. L., VanDerslice, J., Peterson, S. K. 1997 Variation in environmental risk
perceptions and information sources among three communities in El Paso. Risk
Health Safety and Environ., 8: 355-372.
Cervantes, O., Espejel H., Arellano, E., and Delhumeau, S. 2008 Users’ Perception as a
Tool to Improve Urban Beach Planning and Management. Environ. Manage. 42:
249-264.
Field, K. G., and Dick, L. K. 2004 Rapid Estimation of Numbers of Fecal Bacteroidetes
by Use of a Quantitative PCR Assay for 16S rRNA Genes. Appl. Environ.
Microbiol. 70: 5695-5697.
Field, K. G., Dick, L. K., and Simonich, M. T. 2005 Microplate Subtractive
Hybridization To Enrich for Bacteroidales Genetic Markers for Fecal Source
Tracking. Appl. Environ. Microbiol. 71: 3179-3183.
Field, K. G. and Samadpour, M. 2007. Fecal Source Tracking, the Indicator Paradigm,
and Managing Water Quality. Water Research 41: 3517-3538.
Hardwood, V., Staley, C., Badgley, B. D., Borges, K., and Korajkic, A. 2013. Microbial
Source Tracking Markers for Detection of Fecal Contamination in Environmental
Waters: Relationships to Pathogens and Human Health Outcomes. FEMS
Microbiol Rev 38: 1-40.
Hobbs, B. B. 2004 Latino Outreach Programs: Why They need to be Different. Journal of
Extension, 42: 1-4.
Koss-Chioino, J. & Vargas, L. 1999 Working with Latino youth: Culture, development,
and context. San Francisco: Jossey-Bass Publishers.
Layton, A., McKay, L., Williams, D., Garrett, V., Gentry, R., and Sayler, G. 2006
Development of Bacteroides 16S rRNA Gene TaqMan-Based Real-Time PCR
26
Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water.
Appl. Environ. Microbiol. 72: 4214-4224.
Morua, A. R., Halvorsen, K. E., & Mayer, A. S. (2011). Waterborne Disease-Related
Risk Perception in the Sonora River Basin, Mexico. Journal of Risk Analysis,
31: 866-878.
O’Connor, R. E., Bord, R. J., and Fisher, A. 1999 Risk perceptions, general
environmental beliefs, and willingness to address climate change. Risk Anal. 19:
461-471.
Okabe, S., Okayama N., Savichtcheva O., and Ito T. 2007 Quantification of host-specific
Bacteroides–Prevotella 16SrRNA genetic markers for assessment of fecal
pollution in freshwater. Appl. Microbiol. Biotechnol. 74: 890–901.
Parveen, S., Hodge, N. C., Stall, R. E., Farrah, S. R., and Tamplin, M. L. 2001
Phenotypic and Genotypic Characterization of Human and Nonhuman
Escherichia coli. Water Res. 35: 379-386.
Scott, T. M., Rose, J. B., Jenkins, T. M., Farrah, S. R., and Lukasik, J. 2002 Microbial
Source Tracking: Current Methodology and Future Directions. Appl. Environ.
Microbiol. 68: 5796-5803.
Shanks, O. C., et al. 2010 Performance Assessment PCR-Based Assays Targeting
Bacteroidales Genetic Markers of Bovine Fecal Pollution. Appl. Environ.
Microbiol. 76: 1359-1366.
Simpson, J. M., Santo Domingo, J. W., and Reasoner, D. J. 2002 Microbial Source
Tracking: State of the Science. Environ. Sci. Technol. 36: 5279-5288.
Slovic, P. 1987 Perception of Risk. Science 236: 280-285.
Smith, C. J., Rocha, E. R., and Paster, B. J. 2006 The Medically Important Bacteroides
spp. in Health and Disease. Prokaryotes 7: 381–427.
Soller, J.A, Schoen, M. E., Bartrand, T., Ravenscroft, J.E., and Ashbolt, N. J. 2010
Estimated human health risks from exposure to recreational waters impacted by
human and non-human sources of faecal contamination. Water Research 30: 1-18.
Taylor-Clark, K., Koh, H., and Viswanath, K. 2007 Perceptions of Environmental Health
Risks and Communication Barriers among Low-SEP and Racial/Ethnic Minority
Communities. Journal of Health Care for the Poor and Underserved 18: 165–
183.
U. S. Environmental Protection Agency. 2008 Arizona 2008 Water Quality Assessment
Report. http://iaspub.epa.gov/waters10/attains_index.control?p_area=AZ#wqs.
27
U.S. Environmental Protection Agency. 2009 Water Quality Standards [Online.]
http://www.epa.gov/waterscience/standards/wqslibrary/az/az_9_wqs.pdf
U. S. Environmental Protection Agency. 2013. Impaired Waters and Total Maximum
Daily Loads [Online]
http://water.epa.gov/lawsregs/lawsguidance/cwa/tmdl/index.cfm.
Vaughan, E., and Nordenstam, B. The Perception of Environmental Risks among
Ethnically Diverse Groups. Journal of Cross-Cultural Psyc. 22: 29-60.
Viswanath, K., and Emmons, K. M. 2006 Message effects and social determinants of
health: its application to cancer disparities. Journal of Comm., 56: 238-264.
Wexler, H. M. 2007 Bacteroides: the good, the bad, and the nitty-gritty. Clin. Microbiol.
Rev. 20: 593-621.
Williams B. L. and Florez, Y. 2002 Do Mexican Americans Perceive Environmental
Issues Differently than Caucasians: A Study of Cross-Ethnic Variation in
Perceptions Related to Water in Tucson. Environ Health Persp. 110: 303-310.
28
CHAPTER 3: DISSERTATION FORMAT
This Dissertation is presented in a format in which manuscripts in the process of
submission for publication are presented in appendices following this introduction.
Appendix A contains a research article formatted for publication in the Journal of
Environmental Quality. Appendix B contains an extension article formatted for
publication in the Journal of Extension. Appendix C (English), Appendix D (Spanish),
Appendix E (English), and Appendix F (Spanish) contain publications published to the
University of Arizona Cooperative Extension. Appendix G contains raw data for the
publication listed in Appendix A. All research, extension and outreach was conducted in
coordination with the University of Arizona Maricopa Agricultural Center in Maricopa,
Arizona, and the laboratory of Dr. Channah Rock.
29
APPENDIX A
USE OF BACTEROIDES MICROBIAL SOURCE TRACKING IN THE
SAN FRANCISCO RIVER, ARIZONA
(Submitted to the Journal of Environmental Quality)
Berenise Rivera1, 2 and Channah Rock1, 2
1
Department of Soil, Water and Environmental Science, The University of Arizona,
Tucson, Arizona 85721
2
Water Quality Laboratory, Arizona Cooperative Extension, Maricopa Agricultural
Center, Maricopa, Arizona 85138
Corresponding Author
Berenise Rivera
The University of Arizona
Department of Soil Water and Environmental Science
37860 W. Smith Enke Rd, Maricopa, AZ 85138
Ph: 520-381-2235
Email: [email protected]
30
Abstract
Water quality can become compromised by several sources ranging from human
waste (septic tank leakage and recreation), agricultural or livestock operation runoff, and
local wildlife. The genus Bacteroides have been suggested as alternate fecal indicator to
Escherichia coli because they make up a significant part of the fecal bacterial population,
have little potential for re-growth in the environment, and have a high degree of host
specificity that likely reflects differences in host animal digestive systems. The San
Francisco River is currently listed as “impaired” on the US EPA 303 list because it
exceeds water standards for E.coli. Our team worked with the Arizona Department of
Environmental Quality (ADEQ) to employ microbial source tracking (MST) techniques
designed to target specific diagnostic sequences within the 16S rRNA Bacteroides
genome present in feces from human and bovine sources. MST was coupled with
traditional microbiological methods for E. coli bacteria to determine the dominant
sources of fecal contamination in the San Francisco River. Of 70 samples collected over
1year, 81% were positive for universal Bacteroides marker (Allbac). Of the 57 Allbacpositive samples, 68% show contributions of the human-specific marker and 60% were
positive for bovine-specific marker. While 28% of the total samples assayed showed
elevated levels of E. coli (>235 MPN/100mL), there were minimal significant
correlations between Bacteroides and generic E. coli across all samples. This study
proves MST data can be used in conjunction with traditional microbiological methods to
better understand surface water quality impairments, allowing for determination of
specific sources of contamination.
31
Introduction
Fecal contamination poses a health threat in relation to environmental waters used
for drinking water supply, recreational activities, and food production. Fecal
contamination can result from point and non-point sources impacting ground and/or
surface water (Griffith et al., 2003; Roslev and Bukh, 2011). It is crucial to protect water
from fecal contamination that is used for drinking, recreation, and harvesting of seafood
to safeguard human health (Scott et al., 2002). Among the highest risk sources of fecal
contamination is human sewage, which can contain multiple pathogens and humanspecific viruses (Staley et al., 2013). Domestic and agricultural animals can also spread
numerous pathogens; including, Salmonella, E. coli O157:H7, Giardia spp.,
Cryptosporidium spp. (Staley et al., 2013; Field and Samadpour, 2007b). While still a
concern, human health risks associated to fecal waste from wildlife and domesticated
animals are considered to be lower compared to human fecal waste, because viruses, a
common cause of illnesses from exposure to feces, are highly host specific (Roslev and
Bukh, 2011; Field and Samadpour, 2007b). However, due to the potential risks associated
with fecally contaminated water, understanding and identifying the possible sources of
fecal pollution is essential in evaluating related health threats as well as taking the
necessary measures to correct the problem (Scott et al., 2002; Staley et al., 2013).
As a result, microbial source tracking (MST) methods have been developed to
differentiate between these sources of contamination (Hagedorn et al, 2011; Hardwood et
al., 2013). The motivation for emergence of this research area derives from 1) the effort
to determine the extent to which fecal sources influences human health risk from
32
exposure with water and 2) the desire to attribute fecal indicator bacteria (FIB) loading in
water bodies to the correct fecal sources (Harwood et al., 2013). MST is under the
assumption that some characteristics in or related with fecal waste can be used to identify
the feces type or the source (Roslev and Bukh, 2011; Field and Samadpour, 2007b). By
using the appropriate method and appropriate indicator, sources of fecal contamination
can be found and characterized as to animal or human origin (Simpson, Santo Domingo
and Reasoner 2002). MST based on identification of specific molecular markers can
provide a more complete picture of the land uses and environmental health risks
associated with fecal pollution loading in a watershed than is currently possible with
traditional indicators and methods (Jenkins et al., 2009). MST methods have the ability to
identify “who” is contributing to the pollution whereas traditional culture based methods
only tell you “if” and “when” fecal contamination is present. Successfully distinguishing
the sources of fecal contamination, will allow reducing or eliminating diseases associated
with contaminated water as a major cause of health problems (Simpson et al., 2002). This
area of research is of particular interest to state and federal regulatory agencies, such as
EPA and Departments of Environmental Quality, who are charged with reducing both
point and non-point sources of contamination in surface waters. MST can provide more
of a complete picture of the potential sources of fecal contamination than using
traditional indicators, such as E. coli alone.
The bacterial order Bacteroidales is abundant in feces of many warm-blooded
animals, including humans. Due to the abundance of this bacterium in human and animal
feces, it has allowed for host-related analysis targeting genes present in the Bacteroides
33
genome. As stated previously, Bacteroides make up a significant portion of the fecal
bacteria population, have little potential for growth in the environment, and have high
degree of host specificity that likely reflects differences in host animal digestive systems
(Layton et al., 2006). Due to these characteristics, numerous methodologies have been
designed to target specific diagnostic sequences within the Bacteroides 16S rRNA gene
(which is vital for protein synthesis and therefore present in all bacteria) present in feces
from different animals. Katherine Field and colleagues, in particular, have performed
extensive research into the use of Bacteroides 16S rRNA-based PCR assays for MST.
Field and Bernard (2004a) developed 16S rRNA gene makers from Bacteroides to detect
fecal pollution and to distinguish between human and ruminant (e.g., bovine, goat, sheep,
deer, and others) sources by PCR. Developing MST methods specific to molecular
markers within the target gene will allow differentiating between human and ruminant
associated Bacteroides, therefore identifying the possible source of contamination. As
Scott et al. (2002) mentions, this approach offer the advantage of circumventing the need
for a culturing step, which allows a more rapid identification of target organism.
In this study our team used MST techniques coupled with conventional microbial
methods that include a group of methodologies aimed at finding out the dominant sources
of fecal contamination in resource waters. The objective was to differentiate between
human and ruminant sources of fecal contamination by targeting 16S rRNA in surface
water. By characterizing the sources of microbial contamination in the San Francisco
River this work will help to define sources of contamination within the watershed, which
can be used to determine the public health and ecological significance in the area.
34
Moreover, results of this study will be used by the Arizona Department of Environmental
Quality (ADEQ) to strengthen the microbial occurrence database within the state of
Arizona and help to develop an improved management plan for future uses of the river.
Microbial Detection Methods
Site Description. The Upper Gila watershed is located in Eastern Arizona in the
towns of Safford, Duncan, and Clifton. The San Francisco River is currently listed on the
US EPA 303d list due to E. coli exceeding regulatory standards for partial- and full- body
contact. The Upper Gila Watershed is comprised land stretching from Coolidge Dam to
the Arizona-New Mexico border. The watershed covers about 6,000 square miles, of
which 17 percent is privately owned and the remainder is under the stewardship of state,
federal and tribal governments. Citizens can access the river on both private and public
lands to enjoy many outdoor activities. Today the Upper Gila watershed is a destination
for camping, swimming, fishing, hiking, horseback riding and picnicking. Additionally,
the Upper Gila watershed is exploding with development and a clash of urban and rural
values threaten existing water supplies. Increased public awareness of environmental
issues and possible solutions has spawned interest from a diverse community along with
support of the local health officials and monetary support from ADEQ to reduce nonpoint source contamination from local residents. In recent years, this community has seen
the inclusion of ranchers, farmers and miners in efforts to combat pollution in the San
Francisco River and is no longer limited to environmental organizations.
35
Water Sampling. Grab water samples (n=70) were collected in a one liter sterile
polypropylene bottle by our laboratory, the Arizona Department of Environmental
Quality and trained community volunteers from Clifton, Arizona from July 1, 2010
through November 19, 2011.
Sampling Sites. (Figure 1) Sites were selected within the impaired region to monitor
E. coli and areas known for heavy recreational uses.
E. coli. Standard Method # 9223B (1998) was performed using the multi-well
procedure (IDEXX Laboratories, Westbrook, ME). According to the manufacturer
instructions, the substrate was emptied into a 120-mL vessel containing sodium
thiosulfate and 100-mL of sample was added. The bottle was shaken vigorously until the
substrate dissolved and poured into a quanti-tray. The quanti-tray was placed into QuantiTray Sealer 2X (IDEXX Laboratories, Westbrook, ME), and sealed. The quanti-tray was
incubated at 35 ± 5ºC for 24 hours. The most probable number (MPN) value was
obtained from the table provided by the manufacturer by counting the yellow wells for
total coliforms and the fluorescent wells for E. coli.
Molecular Methods
Sample water concentration. Samples were concentrated by membrane filtration
using a 47 mm diameter cellulose acetate membrane with 0.45µm pore size (Pall
Gelmann Laboratory, Ann Arbor, MI). Sample volumes ranged from 10-mL to 500-mL
based on the turbidity of the sample. The filters were placed into individual 15-mL
conical tubes containing 2-mL sterile water and stored at 4ºC until further processing.
36
DNA extraction. The DNA was eluted from the filters by vortexing in 2-mL sterile
water for 10 seconds. Then the water containing the DNA was then transferred to a 2-mL
eppendorf tube. All DNA extractions were performed using QIAmp DNA Stool Kit
(Qiagen Sciences, Valencia, CA) as described by the manufacturer’s instructions. DNA
extractions were stored at -80ºC (-122°F) until molecular testing was performed.
Conventional Polymerase Chain Reaction (PCR). Conventional PCR was used as
a pre-screening tool for the Allbac and HF183 Bacteroides assays. Because the CowM2
assay was designed as a probe based assay, CowM2 was not pre-screened for collected
samples.
The AllBac assay was followed as stated in Layton et al. (2006), and the
Bacteroides species (Allbac) were amplified using a master mix prepared at a
concentration of 1x containing 12.5 µL of GoTaq Green Master mix (Promega
Corporation, Madison, Wisconsin), 1µL of forward AllBac296f primer (5'GAGAGGAAGGTCCCCCAC-3') and 1 µL of AllBac412r primer (5'CGCTACTTGGCTGGTTCAG-3') as previously described (Layton et al, 2006)
(Eurogentec, San Diego, CA). The final concentration was 15pmol of each primer, 2 µL
of sample, and 8.5 µL of nuclease free water for a final volume of 25 µL. Positive
controls contained 2 µL of 300,000 copies of Allbac 296 plasmid insert and the negative
control contained 2 µL of nuclease free water. The tubes were placed into the PCR 96
well thermal Cycler (Applied Biosystems, Foster City, CA) and run in the following
temperature profile: stage one set at 95ºC (2 minutes); stage two set at temperatures
varying from 95ºC (30 seconds), 60ºC (45 seconds), and 72ºC (30 seconds) and run for
37
35 cycles; and, the last stage ends at 72ºC (2 minutes). Once run was completed, the PCR
machine decreased the temperature to 4ºC. The products were visualized in a 1.5%
agarose gel (1.5 g agarose in 100 mL of Tris-Borate EDTA buffer) by comparing the
band intensities to the intensity of a DNA mass ladder (exACTGene, Fisher Scientific,
Canada). Table 1 summarizes the primers, base pair size and annealing temperature used
for both HF183 (described below) and Allbac Bacteroides.
As stated in Seurinck et al. (2005), the human specific HF183 Bacteroides 16S
rRNA sequence specific to human fecal contamination was amplified using a master mix
at a 1x concentration containing 12.5 µL of GoTaq Green Master mix (Promega
Corporation, Madison, Wisconsin) 1µL of forward primer (HF183: 5'ATCATGAGTTCACATGTCCG-3'), 1 µL of newly developed reverse primer (5'TACCCCGCCTACTATCTAATG-3'), 2 µL of sample, and 8.5 µL of nuclease free water
to have final volume of 25 µL. Each primer had a final concentration of 15pmol. A
positive control contained 2 µL of 300,000 copies of HF183 plasmid insert and the
negative control contained 2 µL of nuclease free water. The tubes were then placed into
the PCR Verti 96 well thermal cycler (Applied Biosystems, Foster City, CA) and run in
the following temperature profile: stage one set at 95ºC at one cycle; stage two set at
temperatures varying from 94ºC (30 seconds), 60ºC (1 minute), and 72ºC (2 minute) and
run for 35 cycles; and, the last stage ending at 72ºC (10 minutes). Once the run was
completed, the PCR machine decreased its temperature to 4ºC.
Quantitative Polymerase Chain Reaction (qPCR). After visualizing the products
using conventional PCR, the samples were re-run using qPCR to determine target gene
38
concentrations present in each water sample. Allbac and HF183 PCR (qPCR) assays were
performed using SYBR green PCR Master Mix (Applied Biosystems, Foster City, CA),
with 15pmol of each primer as mentioned above. Plasmid DNA containing 16S rRNA
gene from Bacteroides, HF183 and Allbac respectively, were run as standards using 10fold dilutions of the plasmid ranging from 3.0 X 10⁵ copies to 3 copies. Plasmid DNA
concentration was determined by using NanoDrop ND-1000 UV spectrophotometer.
Quantitative PCR (qPCR) for HF183 was performed using a 12.5 µL reaction mixture
SYBR green, 1 µL of each primer (as mentioned in conventional PCR), 6 µL of nuclease
free water, 2.5 µL of bovine serum albumin (stock BSA at 2 mg/mL) and 2 µL of
sample. The sample was then placed in a well from a MicroAmp Optical 96-well
(Applied Biosystems, Foster City, CA) reaction plate. The same temperature profile from
Seurinck et al (2004) was used. Allbac qPCR were performed using 12.5 µL of SYBR
green and used primers mentioned in conventional PCR, following the same conditions
described in Layton et al. (2006).
The CowM2 (bovine) qPCR assay was performed using TaqMan Universal PCR
Master Mix (Applied Biosystems, Foster City, CA), with 500 uM stock of the forward
(CowM2 F: 5-CGGCCAAATACTCCTGATCGT-3') and reverse (CowM2 R: 5'GCTTGTTGCGTTCCTTGAGATAAT-3') primers, and 100uM (6-FAM
AGGCACCTATGTCCTTTACCTCATCAACTACAGACA TAMRA) of stock
fluoregenic probe (Shanks et al, 2008). CowM2 Bacteroides 16S rRNA sequence was
amplified using a universal master mix at a 2x concentration containing 12.5 µL of
TaqMan Universal Master mix (Applied Biosystems, Foster City, CA), 3.5µL of
39
primer/probe mix (primer/probe mix: 10µl from stock primers and 4 µl of stock probe),
2.5 µl bovine serum albumen from a 2mg/mL stock solution, 2 µL of sample, and 4.5 µL
of nuclease free water to have final volume of 25 µL. Plasmid DNA concentrations were
determined by using NanoDrop ND-1000 UV spectrophotometer. Plasmid DNA
containing 16S rRNA gene from CowM2 Bacteroides, were run as standards using 10fold dilutions of the plasmid ranging from 3.0 X 10⁵ copies to 3 copies. The sample was
then placed in a well from a MicroAmp Optical 96-well manufacturer reaction plate. The
plate was then placed into the qPCR thermal cycler (Applied Biosystems, Foster City,
CA) and run in the following temperature profile: stage one set at 95ºC at one cycle;
stage two set at temperatures varying from 95ºC (15 seconds), 60ºC (1 minute), and 72ºC
(1 minute) and run for 40 cycles; and ending at 4º. For all qPCR reactions, standards,
negative controls (no DNA), and samples were run in triplicates. In order to avoid false
negatives from inhibitors that may be present in the sample which can result in negative
amplification, the samples were diluted 10-fold and 100- fold and were also run in
triplicate. Table 2 summarizes real time conditions for Allbac, HF183 and CowM2
assays.
Amplification control. To monitor PCR inhibition from DNA extractions, Salmon
testes DNA (US EPA 2010) was used to assess inhibition and was added to the final
reaction mixture (Cao et al, 2012). Inhibition can occur when substances present in a
water sample interfere with PCR amplification, which can lead to false-negative results.
Under the Sketa protocol (US EPA 2010), salmon testes DNA is added prior to DNA
extraction and the result is used as a combined sample processing and inhibition control
40
to control for both DNA recovery and presence of inhibition (US EPA, 2010 and Cao et
al, 2012). In this study, salmon testes DNA were added to the extracted DNA rather than
before DNA extraction to 50% of randomly selected samples (using a random number
table provided by Excel) and evaluated for PCR inhibition. Salmon DNA was added to
each well at 2 ng per µl to the final reaction mixture. The CT value was determined by
running blank samples with Salmon DNA at varying concentrations from 0.02ng to
200ng. The expected CT value for amplification of Salmon DNA in uninhibited samples
was determined as the mean CT value of 30. Reactions were deemed inhibited if the CT
value was greater than 30 ± 2.
Statistical Data Analysis. Statistical analyses were performed using the free
programming R version 3.0.1 (R Core Development Team 2013). Specific comparisons
between parameters (E.coli concentrations, sample location, and Bacteroides markers)
were analyzed by correlation test with p-values less than 0.05 considered being
statistically significant.
Results and Discussion
A total of 70 samples were collected from July 1, 2010 to November 19, 2011.
Monthly samples were collected from the ten identified sites: Upper San Francisco,
Upper Blue, Lower Blue, State Lands/BLM, State Lands Main Crossing, State Lands
Hole in the Rock, Kaler Deeded Land, Clifton N. End Bridge, Clifton at Old Dump and
Below Morenci Gulch. Sites were selected based of the US EPA 303d list of impaired
locations flowing downstream where the river runs through the town of Clifton, AZ. E.
41
coli concentrations per site indicate that 8 of the 10 sites exceeded the US EPA National
standards for full body contact (FBC) of 235 cfu/100mL and 7 of the 10 sites exceeded
the partial body contact (PBC) standards of 575 cfu/100mL (Figure 2). Of the total 70
samples that were analyzed 93% were positive for E. coli. It is important to note that all
exceedances occurred in warm weather conditions likely after summer rains had begun.
Typically, Clifton, Arizona receives 5 inches of rain during the summer months
(Greenlee County, 2011). In areas affected by moderate to heavy recreation or livestock
watering, E. coli concentrations remained in the exceedance range while temperatures
were elevated. The average temperatures in Clifton, Arizona during the summer months
range from 97° F to 100° F (Greenlee County, 2011). The presence of E. coli in surface
waters is often attributed to fecal contamination from agricultural and urban/residential
areas. In this study, locations State Lands Main Crossing and State Lands Hole in the
Rock seemed to consistently have the highest concentrations of E. coli when compared to
other sample locations within the watershed. Through our data it is apparent that E. coli
concentrations at particular locations may vary depending on the bacteria level already in
the river, inputs from point and non-point sources, and die-off or multiplication of the
organism within the river water.
When the data was analyzed our research team also considered seasonal impacts
to water quality and used the following months for each seasonal evaluation; Spring
(March-May), Summer (June-August), Fall (September-November), and Winter
(December-February). Seasonal impacts are especially important in the southwest during
monsoon season (mid-June to late-September) when there can be intense rain events in
42
the region being studied. These peak rain events and subsequent overland flow increase
agricultural and urban runoff (non-point sources); which may contribute to surface water
contamination. Evaluating the data seasonally allowed our research team to better
understand how these events may influence pollutant loading to the watershed. Samples
were not collected during the spring but were collected for summer, fall and winter. High
concentrations of E. coli occurred in the summer months with 96% of all samples
collected exceeding FBC and PBC standards. Also, 88% of E. coli exceedances recorded
occurred in the summer monsoon months (June-September) in both 2010 and 2011.
Overall, E. coli concentrations and exceedances were higher in the summer of 2011 than
the previous summer. This may be due to increased sedimentation and nutrient loading of
the streams from summer rain run-off following the Wallow fire of 2011 (ADEQ, 2012).
Also, high E. coli concentrations may be due to unmanaged recreation in multiple areas
along the river. In the fall months of 2011, 5% of the samples exceeded FBC and PBC
standards at the SFR State Lands Main Crossing site. Samples collected during the winter
season consistently showed low concentrations of E. coli numbers regardless of site.
In order to better understand and identify point and non-point sources of pollution
in the watershed, Bacteroides molecular markers were used to identify the presence of
Allbac, HF183 (human) and CowM2 (bovine) in the San Francisco River. Standard PCR
was used as an initial screening technique to see if the markers were present, followed by
qPCR to quantify the molecular genes. The quantification can be used to determine
relative quantities between each sample location. Also, molecular quantification can be
used to determine if a correlation exists between E. coli and Allbac, HF183 or CowM2
43
molecular markers. Of the total 70 samples that were analyzed using molecular methods,
77% were positive for Allbac molecular markers and figure 3 depicts the concentrations
of Allbac copy numbers per 100 mL for each of the ten samples sites. Varying
differences in concentration of Allbac molecular markers were seen for each site with
State Lands Hole in the Rock, Kaler Deeded Land and Clifton at Old Dump showing a
greater range in concentrations of markers than other sites evaluated. Figures 4 and 5
show the ranges in concentrations of gene copies per 100 mL of HF183 and CowM2 gene
targets respectively. When comparing these figures, it should be noted that gene copies at
sample sites higher in the watershed (up-stream) tend to have less variability while sites
downstream (closer to town and recreational impacts) tend to have a wider range in gene
target concentrations shown in Figures 3 through 5 by taller box plots. Seasonal impacts
were apparent and for all sample sites Allbac (92%) and HF183 (48%) molecular markers
were found at higher numbers in the summer months. Human impacts have also been
tied to increased recreation in certain locations in the watershed. CowM2 (56%)
molecular markers were found at higher number in the fall. This could be due to effects
of grazing patterns in the watershed where cattle have been documented to be ranging
near the river (ADEQ, 2012). Figure 5; show the concentrations of CowM2 molecular
markers per 100 ml, sites overall show low variability with the highest distribution seen
at Below Morenci Gulch. Human impacts have also been tied to increased recreation in
certain locations in the watershed. Analysis suggests that these fluctuations coincide with
extreme storm events and thus are a result of increased overland flow. Eighteen (24%) of
44
the 70 samples showed inhibition and were further diluted to 1:10 and 1:100 to reduce
inhibition.
Although, microbial indicator organism E.coli and molecular markers for
Bacteroides were detected in all sample locations evaluated in this study, only the Lower
Blue site showed statistically significant correlations for all three molecular markers:
HF183, Allbac and CowM2 (p=0.02, 0.001, and 0.02). There were two sites that were
showed statistically significant correlations between E. coli concentrations and Allbac,
Kaler Deeded Land (p=0.003) and Clifton North End (p=0.001). No significant
correlations were observed based on concentrations of organisms detected for the other
sampling sites during the sampling period. All correlations exceeded the set of 0.05 were
not considered to be statistically significant but any p-values less than 0.05 considered
being statistically significant (Table 3).
Conclusions
Surface waters often contain traces of fecal contamination from several source
groups; it is not surprising to detect molecular markers from different sources during our
MST studies (Roslev and Bukh, 2011, Gourmelon et al, 2007). Throughout the study
period, E. coli was detected during summer, fall and winter indicating fecal
contamination and the potential of harmful pathogens present in the San Francisco River
which can pose a human health risk. From our data, we can clearly see E. coli
fluctuations throughout the sites with 96% of the samples exceeding PBC and FBC
during the summer months. The concentration of E. coli in surface water depends for the
45
most part on the runoff from non-point sources and recreational activities. Of 70 samples
collected over 1 year, 81% were positive for universal Bacteroides marker (Allbac). Of
the 57 Allbac-positive samples, 68% show contributions of the human-specific marker
and 60% were positive for bovine-specific marker. While 28% of the total samples
assayed showed elevated levels of E. coli (>235 MPN/100mL), there was no significant
correlations between Bacteroides and generic E. coli across all samples. The presence of
human molecular markers can be an indication that human recreational activities
impacting the watershed at the locations mentioned previously. Livestock watering and
wildlife within the watershed may be contributing to Allbac molecular markers. Also,
agricultural activities such as runoff during monsoon season may be contributing to
Allbac molecular markers. As mentioned before, in many locations throughout the
watershed it has been noted certain sites are used for livestock watering which are
contributing to bovine molecular markers.
This study proves that MST data can be used in conjunction with traditional
microbiological methods to better understand surface water quality impairments,
allowing for determination of specific sources of contamination. By identifying the
sources of fecal contamination in the watershed, furthers studies can be designed to better
understand potential inputs identified by MST and how to mitigate pollutant loading from
those sources. It is important to acknowledge that MST has come a long way but this
study benefited from looking at different parameters other than source associated
markers. The results from this study helped the Gila Watershed Partnership of Arizona (a
local non-profit group that works to improve the Upper Gila Watershed) secure a
46
$199,245 grant from the Arizona Department of Environmental Quality to start
construction of restroom facilities in heavily used recreation areas on the San Francisco
River north of the Town of Clifton in Greenlee County. Human MST provided evidence
that contamination is directly related to unmanaged recreation in multiple areas (ADEQ,
2012).
The grant is one of three awarded in Arizona this year administered by ADEQ’s water
quality improvement grant program to address polluted runoff from many different
sources. In addition, the data collected in this study will be used to develop an outreach
program for community members. Furthermore, this study can be used to work with
local, state and government agencies to address the problems.
47
References
American Public Health Association, American Water Works Association, and Water
Environment Federation. 1998. Standard Methods for the Examination of Water
and Wastewater 20th Edition. Eds. Clesceri, L. S., Greenberg, A. E. and Eaton, A.
D. United Book Press Inc, Baltimore, MD.
Arizona Department of Environmental Quality. 2010. Water Quality. [Online]
http://www.azdeq.gov/environ/water/index.html.
Arizona Department of Environmental Qualtity. 2012. Watershed Improvement Plan San
Francisco and Blue Rivers. [Online]
http://lists.azdeq.gov/environ/water/watershed/download/san_fran_blue-wip.pdf
Cao, Y., Griffith, J. F., Dorevitch, S., and Weisberg, S. B. 2012. Effectiveness of qPCR
permutations, internal controls and dilution as means for minimizing the impact of
inhibition while measuring Enterococcus in environmental waters. Appl. Environ.
Microbiol. 113: 66-75.
Field, K. G., and Dick, L. K. 2004a. Rapid Estimation of Numbers of Fecal Bacteroidetes
by Use of a Quantitative PCR Assay for 16S rRNA Genes. Appl. Environ.
Microbiol. 70:5695-5697.
Field, K. G., and Samadpour, M. 2007b. Fecal Source Tracking, the Indicator Paradigm,
and Managing Water Quality. Water Res 41: 3517-3538.
Gourmelon, M. Caprais, M. P., Segura, R., Le Mennec C., Lozach, S., Piriou, J. Y., and
Rince, A. 2007. Evaluation of Two Library-Independent Microbial Source
Tracking Methods To Identify Sources of Fecal Contamination in French
Estuaries. Appl. Environ. Microbiol. 73: 4857-4866.
Greenlee County. 2011. Greenlee County Multi-Jurisdictional Hazard Mitigation Plan.
[Online]
http://www.co.greenlee.az.us/emergency/Greenlee%20County%20Multi%20Juris
%20Haz%20Mit%20Plan_Draft_June%202011.pdf.
Griffith, J. F., Weisberg, S. B., and McGee C. D. 2003. Evaluation of microbial source
tracking methods using mixed fecal sources in aqueous test samples. J. Wat.
Health 1: 141-151.
Hagedorn, C., Blanch, A. R., and Hardwood, V. J. 2011. Microbial Source Tracking:
Methods, Applications, and Case Studies. New York, NY: Springer-U.S.
48
Harwood, V. J., Staley, C., Badgley, B. D., Borges, K., and Korajkic, A. 2013. Microbial
Source tracking markers for Detection of Fecal Contamination in Environmental
Waters: Relationship between pathogens and Human Health outcomes. FEMS
Microbiol Rev 38:1-40.
Jenkins, M. W., Sangam, T., Lorente, M., Gichaba, C. M., and Wuertz, S. 2009.
Identifying human and livestock sources of fecal contamination in Kenya with
host-specific Bacteroidales assay. Water Research 43: 4956-4966.
Layton, A., McKay, L., Williams, D., Garrett, V., Gentry, R., and Sayler, G. 2006.
Development of Bacteroides 16S rRNA Gene TaqMan-Based Real-Time PCR
Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water.
Appl. Environ. Microbiol. 72: 4214-4224.
R Core Development Team. 2013. R: A Language and Environment for Statistical
Computing: Vienna, Austria: R Foundation for Statistical Computing.
Roslev, P., and Bukh, A. S. 2011. State of the Art Molecular Markers for Fecal Pollution
Source Tracking in Water. Appl Microbiol Biotechnol 89: 1341-1355.
Scott, T. M., Rose, J. B., Jenkins, T. M., Farrah, S. R., and Lukasik, J. 2002. Microbial
Source Tracking: Current Methodology and Future Directions. Appl. Environ.
Microbiol. 68: 5796-5803.
Seurinck, S., Defoirdt, T., Vestraete, W., and Siciliano, S. D. 2004. Detection and
quantification of the human-specific HF183 Bacteroides 16S rRNA genetic
marker with real-time PCR for assessment of human faecal pollution in
freshwater. Environ. Microbiol 7: 249-259.
Shanks, O. C., Atikovic, E., Blackwood, A. D., Noble, R. T., Santo Domingo, J.,
Seifring, S., Sivaganesan, M. and Haugland, R. A. 2008. Quantitative PCR for
genetic markers of cattle fecal pollution. Appl. Environ. Microbiol. 74: 745-752.
Simpson, J. M., Santo Domingo, J. W., and Reasoner, D. J. 2002. Microbial Source
Tracking: State of the Science. Environ. Sci. Technol. 36: 5279-5288.
Staley, Z. R., Chase, E., Mitraki, C., Crisman, T. L., and Hardwood, V. 2013. Microbial
Water Quality in Freshwater Lakes with Different Land Use. Appl. Microl. 115:
1240-1250.
U. S. Environmental Protection Agency. 2010. Method A: Enterococci in water by
TaqMan Quantitative Polymerase Chain Reaction (qPCR) Assay. EPA-821-R-10004. Washington, DC: Office of Water.
49
1.Upper San Francisco, 2. Upper Blue, 3. Lower Blue, 4.State Lands/BLM, 5.State Lands
Main Crossing, 6. State Lands Hole in the Rock, 7.Kaler Deeded Land, 8. Clifton N. End
Bridge, 9.Clifton at Old Dump, and 10.Below Morenci Gulch
Figure 1. San Francisco River Watershed Sampling Sites
50
Assay
Primer
Sequence
Allbac 296f
5’-GAGAGGAAGGTCCCCCAC-3’
Allbac
HF183
Allbac 412r
5’-CGCTACTTGGCTGGTTCAG-3’
HF183f
5’-ATCATGAGTTCACATGTCCG-3’
Newly
Developed
Reverse
5’-TACCCCGCCTACTATCTAATG-3’
Cow M2f
5’-CGGCCAAATACTCCTGATCGT-3’
Cow
M2
Cow M2r
5’-GCTTGTTGCGTTCCTTGAGATAAT-3’
Table 1. PCR Primers and Reaction Conditions
Target
BP
size
Annealing
Temp (°C)
Reference
Total
106
60°C
Layton et
al, 2006
Human
82
60°C
Seurinck et
al, 2005
Bovine
92
60°C
Shanks et
al, 2008
51
Reference
Holding Cycle
Cycling Stage
Melting Curve Stage
Allbac
(Layton et al,
2006)
50°C for 2 minutes
95°C for 30 seconds
95°C for 15 seconds
95°C for 10 minutes
60°C for 45 seconds
60°C for 1 minute
50 cycles
95°C for 30 seconds
50°C for 2 minutes
HF183
(Suerinck et
al, 2005)
53°C for 1 minute
95°C for 15 seconds
95°C for 10 minutes
60°C for 1 minute
40 cycles
95ºC for 15 seconds
CowM2
(Shanks et al,
2008)
50ºC for 2 minutes
60ºC for 1 minute
95ºC for 10 minutes
60ºC for 1 minute
60ºC for 1 minute
40 cycles
Table 2. Quantitative PCR Real-Time Conditions
52
1. Full Body Contact= 235 CFU/100 mL
2. Partial Body Contact= 575 CFU/100 mL
Figure 2. Average E.coli Concentrations Per Location (n=70)
53
1.00E+14
Allbac gene copies/100mL
1.00E+12
1.00E+10
1.00E+08
1.00E+06
1.00E+04
1.00E+02
1.00E+00
Upper San Upper Blue Lower Blue
State
State
State
†Kaler
Francisco
Lands/BLM Lands Main Lands Hole Deeded
Cross in the Rock
Land
Clifton
Clifton at
North End Old Dump
Bridge
Box plot depicts Allbac gene copies/100mL for each site on the San Francisco River. The lower boundary of the box indicates
the 25th percentile, then line within the box represents the median, and the boundary of the box farthest from the zero indicates
the 75th percentile. † The lower quartile for this site is 1.0E-06
Figure 3. Boxplot of Allbac concentrations of the San Francisco River
Below
Morenci
Gulch
54
1.00E+14
HF813 gene copies/100mL
1.00E+12
1.00E+10
1.00E+08
1.00E+06
1.00E+04
1.00E+02
1.00E+00
† Upper San Upper Blue Lower Blue
State
State
State
Francisco
Lands/BLM Lands Main Lands Hole
Cross in the Rock
Kaler
Deeded
Land
Clifton
Clifton at
North End Old Dump
Bridge
Box plot depicts HF183 gene copies/100mL for each site on the San Francisco River. The lower boundary of the box indicates
the 25th percentile, then line within the box represents the median, and the boundary of the box farthest from the zero indicates
the 75th percentile. †The lower quartile for this site is 1.0E-01
Figure 4. Boxplot of HF183 concentrations of the San Francisco River
Below
Morenci
Gulch
55
1.00E+14
CowM2 gene copies/100mL
1.00E+12
1.00E+10
1.00E+08
1.00E+06
1.00E+04
1.00E+02
1.00E+00
Upper San Upper BlueLower Blue State
Francisco
Lands/BLM
State
State
Kaler
Lands Lands Hole Deeded
Main Cross in the Rock Land
Clifton
Clifton at
North End Old Dump
Bridge
Below
Morenci
Gulch
Box plot depicts CowM2 gene copies/100mL for each site on the San Francisco River. The lower boundary of the box
indicates the 25th percentile, then line within the box represents the median, and the boundary of the box farthest from the zero
indicates the 75th percentile.
Figure 5. Boxplot of CowM2 concentrations of the San Francisco River
56
Site
Upper San Francisco (n=8)
Upper Blue (n=7)
Lower Blue (n=11)
State Lands/BLM (n=1)
State Lands Main Crossing (n=13)
State Lands Hole in the Rock
(n=10)
Kaler Deeded Land (n=6)
Clifton North End Bridge (n=3)
Clifton at Old Dump (n=8)
Below Morenci Gulch (n=3)
Allbac
HF183
CowM2
0.3072
0.2636
0.1102
0.001***
0.0209**
0.0231**
0.000000578
0
0.000294
NOB
NOB
NOB
0.468
0.2605
0.4502
0.3155
0.3192
0.4528
0.003*
0.5965
0.6165
0.001***
0.6652
0.6652
0.1239
0.801
0.1481
0.0000000134
2.2E-16
0.6667
Table 3. The correlation (p-values) between E. coli concentrations and Bacteroides
molecular markers for each site
57
APPENDIX B
Use of Survey Methods to Enhance Watershed Education of
Minority Populations in Clifton, AZ
(Submitted to the Journal of Extension)
Berenise Rivera
Ph.D. Candidate
Department of Soil, Water and Environmental Science
The University of Arizona
Maricopa, Arizona
[email protected]
Channah Rock, Ph.D.
Associate Professor
Department of Soil, Water and Environmental Science
The University of Arizona
Maricopa, Arizona
[email protected]
58
Abstract
The San Francisco River is impaired due to E. coli exceedances, posing health risks to
visitors and the community. Minority populations may be of particular concern due to
environmental and economic disproportions. In 2012, public perception surveys were
conducted to evaluate water quality attitudes towards the San Francisco River in Clifton,
Arizona, composed of about 60% Hispanic population. In general 66% of respondents
indicate they are concerned with poor water quality and their health. Survey findings will
be used to better tailor outputs appropriate for the targeted audience, namely the local
Hispanic population and enhance watershed education in the community.
Keywords: community outreach, Hispanic populations, water quality
59
Introduction
The Upper Gila Watershed is composed of the San Francisco River (SFR) in northeastern
Arizona. Portions of this river has been listed as impaired on the US EPA 303d list for
Escherichia coli (E. coli) concentrations exceeding the regulatory standards for health
protection. In 2012, a targeted Watershed Improvement Grant devised by the Gila
Watershed Partnership (a local non-profit group) with the support of the Arizona
Department of Environmental Quality (ADEQ), U.S. Environmental Protection Agency
(EPA) and the University of Arizona (ADEQ, 2012) was developed to identify sources of
contamination and ultimately reduce E. coli loading in the SFR. Clifton, Arizona the local
community adjacent to the rivers of concern is composed of approximately 60%
Hispanic. As part of the GWP targeted Watershed Improvement Grant, local stakeholders
worked with the University of Arizona Cooperative Extension to collect water samples
and used Microbial Source Tracking (MST), a bacterial genetic testing method
commonly used to identify potential pollution sources. MST methods have been used
(Layton et al., 2006; Seurinck et al., 2005; and Shanks et al, 2008) in conjunction with
traditional microbiological methods to better understand surface water quality
impairments, allowing for determination of specific sources of contamination. By
identifying the sources of fecal contamination in the watershed, more informed decisions
can be made regarding the most effective management practices implemented to mitigate
pollutant loading from those sources.
MST data coupled with anecdotal evidence suggests that the predominant source of
contamination in the SFR is a result of human recreation impacts across the watershed
60
(Rivera and Rock, 2014, in review). Human sources of fecal pollution represent a serious
health risk because of the high likelihood of the existence of human pathogens. Although
information like this is critical to formulate solutions to proper watershed management,
through past studies we have learned that successfully distinguishing the sources of fecal
contamination will not alone reduce or eliminate disease associated with contaminated
water unless these investigations are coupled with effective and targeted public outreach
and education. This may be of particular importance when working with minority
populations.
Past research has determined that perceptions and attitudes are key factors that shape
human decision-making and behavior (Armstrong, et al., 2012; Kaisser, Wolfing, &
Fuhrer, 1999). Because culturally based attitudes and values can influence general
orientation toward risk and uncertainty, it is reasonable to expect that factors
differentiating individuals on the basis of shared experiences, values, and beliefs relevant
to risk evaluation will be associated with nonequivalent perceptions in many situations
(Cervantes et al., 2008). Taylor-Clark, Koh, & Viswanath (2007) state, people’s potential
for social action and participation is influenced by how they perceive a social condition
as a problem and the information that they have to mobilize and act on resolving that
problem. It is also well understood that understanding different types of people in the
community can help refine education and outreach messages (Prokopy et al., 2010; US
EPA 2002, 2003; Coburn & Donaldson, 1997). Based on this body of knowledge, it is
then appropriate to conclude that in order to serve the educational needs of the public
about water quality, a better understanding of people’s concerns, priorities, and
61
willingness to implement practices designed to improve water quality is needed. Our
current research aims to better understand the interaction between research and the public
to promote greater understanding of the issues that affect water quality and human health
specifically those of minority populations in Clifton, AZ. This article presents findings
from a public perception survey aimed at: 1) identifying how Clifton minority residents
perceive the effects of environmental risks on their own health (or if they recognize a risk
at all); (2) what information is available to residents; and 3) how accessible is the
information to local minority residents.
Background
Our team employed MST techniques designed to identify specific diagnostic sequences
within the 16S rRNA Bacteroides genome present in feces from human and bovine
sources. MST was coupled with traditional microbiological methods for E. coli bacteria
(IDEXX Colilert Quantitray, Standard Method # 9223B, 1998) to determine the dominant
sources of fecal contamination causing exceedances in the SFR. Of 70 water samples
collected from July 2010 through November 2011 by University of Arizona Cooperative
Extension or trained volunteers, 81% were positive for universal Bacteroides marker
(Allbac). Of the 57 Allbac-positive samples, 68% show contributions of the humanspecific marker and 60% were positive for bovine-specific marker. While 28% of the
total samples assayed showed elevated levels of E. coli (>235 MPN/100mL). This data
demonstrates that MST can be used in conjunction with traditional microbiological
62
methods to better understand surface water quality impairments, allowing for
determination of specific sources of contamination.
Recently, the Upper Gila Watershed is exploding with development and a clash of urban
and rural values threaten existing water supplies. Increased public awareness of
environmental issues and possible solutions has spawned interest from a diverse
community along with support of the local health officials and monetary support from
ADEQ to reduce non-point source contamination from local residents. In recent years,
this community has seen the inclusion of ranchers, farmers and miners in efforts to
combat pollution in the SFR and is no longer limited to environmental organizations.
Nonetheless, one of the major groups often underrepresented during community
discussions on environmental issues, water quality, and human health is the large local
Hispanic population. In order to better tailor future Cooperative Extension education and
outreach efforts related to the sources of E.coli contamination in the SFR, our team
developed survey methodologies, targeting the local Hispanic population.
Materials and Methods
For the purpose of this study, where little was known about perceptions of water quality
in the Upper Gila Watershed, the survey provided insight on the participants’ perceptions.
Our study took place in Clifton, Arizona; which is a rural community along the SFR. It is
important to mention that Clifton, AZ is adjacent to Morenci, AZ which is home to the
largest open-pit copper mine in the United States. A survey was developed to gather
63
information about water quality perceptions, water use, peoples’ attitudes, knowledge,
and behaviors related to the water resources. Survey questions consisted of multiple
choice and Likert scales questions and were provided in both English and Spanish and
were conducted during the summer of 2012 and winter of 2013. All surveys were
presented in written or oral format and were conducted during community and outreach
events targeting local Hispanic community members. Additionally, a sub-set of surveys
were passed out to local Hispanic leaders of the community to pass along to relatives,
friends, and neighbors. A total of 150 surveys were deployed with 38 surveys completed
for a response rate of 25%. During these events an informed consent script was read in
English and/or Spanish. For subject’s that agreed to participate, a disclosure form was
provided to them to keep and the survey was collected at the end of the meeting/event.
The survey consisted of 6 main topics (Table 1).
Table 1. Survey Topics
 Water Quality
 Water Use
 General Water Quality Attitudes
 Sources of Water Pollution
 Consequences of Poor Water Quality
 Information Transfer
Results and Discussion
Water Quality and Use
Questions 1 related to water quality perceptions are presented in Figure 1. Understanding
how the residents rated the quality of water of the SFR was important because the
64
responses provided insight on how they might use surface waters. Roughly, 84% of
respondents consider the river safe for family picnics and activities near the river yet over
80% of the participants reported the SFR has poor water quality for drinking; and 39%
agree the SFR has poor water quality for swimming. Additionally, the majority (34%) of
the participants feel it is okay to eat locally caught fish in the SFR. We followed the
water quality question by asking how often they use or come in contact with the SFR.
Forty five percent of those surveyed come into contact with the SFR a few times a year,
while 24% use the river once a month. Only 13% reported using the river every day,
compared to 11% never coming into contact with the river at all.
Percent of Respondents (%)
100
Poor
Okay
Good
Don't Know
80
60
40
20
0
1
2
3
Water Activities
Figure 1. Water quality rating of the local river: (1) eating locally caught fish, (2)
swimming, (3) Picnicking and Family activities and (4) drinking.
4
65
General Water Quality Attitudes
Figure 2 represents the question of general water quality attitudes. Of those surveyed,
45% strongly agree their actions impact the river and it is important to protect water
quality even if it slows economic development. On the other hand, only 5% strongly
disagree with it is important to protect the river even if it slows economic development.
Thirty seven percent strongly agree, 50% agree, 7% neither agree nor disagree, and 2%
disagree and strongly disagree that it is their personal responsibility to help protect water
quality. When asked about if quality of life in their community depends on “acceptable”
water quality, 32% strongly agree, 39% agree, and 18% neither agree nor disagree. To get
a better understanding if residents would be willing to take the necessary actions to
mitigate pollution problems, we asked respondents if they would invest monetary support
to improve water quality in the river and 21% strongly agree with the majority of
respondents agree (47%). When asked if economic stability of their community depends
upon clean rivers 26% strongly agree and agree with 11% neither agree nor disagree and
2% disagree. The participants were also asked if it is important to protect water quality
even if it costs them more and 24% strongly agree, 29% agree and 5% neither agree nor
disagree and disagree. The following question received very similar responses when
asked about if the way they care for their property can influence water quality in rivers
with 24% strongly agree, 29% agree, 7% neither agree nor disagree, 2% disagree and
strongly disagree. Toward the end of these questions the responses starting shifting more
to the left side of the scale with more negative responses. We followed the previous
question by asking what you do on your property doesn’t have much impact on overall
66
water quality and 16% agree, 5% neither agree nor disagree, with the highest being 24%
disagree and 18% strongly disagree. Eleven percent of respondents agree that taking
action to improve rivers and streams is too expensive for them, while 13% neither agree
nor disagree, 21% disagree and 18% strongly disagree. Therefore, we can infer that the
majority of residents agree that they would financially support river improvement
projects. Lastly, 26% strongly disagree and 34% disagree that it is okay to reduce water
quality to promote economic development with 5% of those surveyed neither agreeing
nor disagreeing.
67
Strongly Disagree Disagree Neither Agree nor Disagree Agree
My actions have an impact on rivers and
5 11
39
streams
It is important to protect water quality even if it
slows economic development
5 5
18
45
50
8
18
I would be willing to pay more to improve rivers
25
and streams
21
The economic stability of my community
2 11
depends upon clean rivers and streams
37
39
32
47
26
26
5 5
29
24
The way that I care for my property can
22 7
influence water quality in rivers and streams
29
24
It is important to protect water quality even if it
costs me more
What I do on my property doesn't have much
impact on overall water quality
18
24
5
Taking action to improve rivers and streams is
too expensive for me
18
21
13
It is okay to reduce water quaility to promote
economic development
45
24
It is my personal responsibility to help protect
22 7
water quality
The quality of life in my community depends on
good water quality in local streams and rivers
Strongly Agree
26
34
21
16
11
5
Figure 2. Respondents’ attitudes (%) of general water quality in the San Francisco River.
Sources of Water Pollution
As mentioned at the beginning of the paper, our team has identified sources of water
contamination in the SFR but we did not know what the residents thought were the
sources of contamination. The questions in the survey allowed us to gain insight to what
are the residents’ opinions regarding the sources of contamination. In question 4, we
listed sources of water quality pollution to get the opinion of how much of a problem are
68
the following sources in the SFR (Figure 3). When asked about discharges from industry
and sewage treatment plants, 29% and 24% respectively, think it is a severe problem. Of
those surveyed, 26% agree soil erosion from construction sites to be a severe problem,
while 24% and 26% respectively agree soil erosion from farm fields and stream channels
to be a moderate problem. Grazing related sources (39%) and manure from farm animals
(37%) agree this is a moderate problem. Based on the results of our previous research,
recreational activities and improperly maintained septic systems are potential sources of
contamination but only 21% of residents think this is moderately to severe problem.
69
Not a Problem
Slight Problem
Moderate Problem
Pet waste such as dogs or cats
Soil erosion from farm fields
Manure from farm animals
Improperly maintained septic systems
Grazing-related sources
Soil erosion from construction sites
26
24
11
Droppings from birds, ducks, or waterfowl
24
11 7
37
7
21
18
21
39
7 7 11
21
5 7 13
18
18
Lawn fertilizers and pesticides
7 11 7
18
18
Removal of riparian vegetation
5 5 18
24
18
16
16
21
18
26
7 13
Animal feeding operations
7 5 18 2
Grass clippings and leaves
11 13
26
11
Agricultural fertilizers or redevelopment
5 7
24
18
5 13 2
Soil erosion from stream channels
21
18
Discharges from sewage treatment plants
Stormwater runoff from strees,… 2 11
11
18
29
18
21
Don't Know
5 18
26
16 5 13 11
13
7
16
11
Discharges from industry into streams… 5 7 5
Land development or redevelopment
18
29
18
Severe Problem
7
26
18 2 13
Figure 3. Respondents’ opinions (%) on how much of a problem the following sources
are in the San Francisco River.
Consequences of Poor Water Quality
Because poor water quality can lead to a plethora of diseases and estimated to cause
about 10% of all diseases worldwide (Robles Morua et al., 2011), we felt it was
imperative to survey respondents about consequences of poor water quality. Table 2,
shows the distribution of responses regarding perception of the consequences associated
70
with poor water quality. The majority agree there is a severe problem in the SFR. After
inquiring about consequences of poor water quality, we asked if they are concerned with
poor water quality and their health. Over half of the respondents, 66% are concerned with
poor water quality and their health; on the other hand, 24% indicated that they are not
concerned (data not shown).
Not a
Slight Moderate Severe
Problem Problem Problem Problem
Don't
know
Contaminated
Drinking water
16%
18%
18%
26%
21%
Polluted/ closed
swimming areas
16%
7%
42%
21%
11%
Contaminated fish
2%
5%
11%
32%
13%
7%
13%
7%
13%
18%
2%
2%
5%
34%
18%
16%
11%
21%
42%
8%
16%
16%
24%
39%
5%
0%
11%
13%
34%
7%
5%
7%
11%
29%
11%
2%
7%
2%
39%
11%
Odor
24%
18%
18%
29%
7%
Lower property
values
5%
2%
13%
21%
21%
Increase in water/
sewage bill
Loss of desirable
fish and wildlife
species
Reduced beauty
of river and
streams
Reduced
opportunities for
water activities
such as boating,
canoeing and
fishing
Reduced quality
of water activities
Excessive aquatic
plants or algae
Fish kills
71
Developing skin
rash
Developing
Diarrhea
Exposure to
disease causing
bacteria
2%
11%
5%
29%
16%
5%
7%
5%
26%
16%
5%
18%
21%
26%
26%
Table 2. The distribution of respondents regarding poor water quality. (Numbers in bold
represent highest response rates for each individual category).
Information Transfer
The final questions of the survey asked respondents about where they obtained their
information regarding water quality. This is important as new resources are developed, it
is imperative that the local community sees them as available and from a trusted source.
Sixty eight percent of residents get their information regarding their local water quality in
the newspaper, brochures, and/or pamphlets (Figure 4). Almost 61% claimed obtaining
information from conversations with others. Clifton, Arizona has a population of almost
3,000 people and as mentioned before it is composed of around 56% Hispanic, the
majority being Mexican American which is a very closely knitted community. Of those
surveyed, 16% get information from the City or Public Health office, while 21% use
other sources. Only 7% obtain water quality information by conducting their own
inspection (visually) and 5% by attending workshops and/or demonstrations. Lastly, 2%
of residents learn about their local water via television or radio.
72
Television, 2 Radio 2
Other, 21
City/Public Health
Office, 16
Workshops/demonst
Newspaper/
ration, 5
factsheet/brochure,
68
Own inspection, 7
Conversations with
others, 61
Figure 4. Ways used by residents (%) to get information about water quality.
Challenges and Recommendations
The main goal of our study was to assess water quality perceptions among Hispanic in
order to inform future outreach and education efforts. Unfortunately, several challenges
engaging the Hispanic community described below:

Hispanics are more at risk from waterborne diseases yet they are less likely to
perceive the river as a risk (Morua et al., 2011).

Low health and science literacy among Clifton residents, in particular among the
Hispanic population.

The health of the SFR is not a primary priority among many local community
groups (personal communication).

Lack of community of involvement, in particular among the Hispanic population.
73

Hispanic population turning down survey completion either due to lack in agency
trust, fear or simply do not want to get involved.
Hispanic families living in the area have a traditional, multi-generational attachment to
the river and the SFR is a local attraction that local families and tourists enjoy. Therefore
we can make several recommendations to engage the greater Hispanic population.

Target messaging during the summer and fall seasons.

Verbiage in outreach materials will target 4th grade reading level.

All outreach material will be bi-lingual, in English and Spanish.

Trusted Hispanic leaders will be engaged to work with the Hispanic community to
disseminate information.
Conclusions
A number of studies have assessed perceptions regarding the causes of waterborne
disease and the results have been mixed, with most studies finding that individuals did
not understand that contaminated water was putting them at great risk of waterborne
disease (Morua et al., 2011). Our study supports these findings with survey results
suggesting that attitudes and perceptions are vague toward water quality and public health
in Clifton, AZ. It was not surprising to see mixed attitudes on water quality with 80%
reporting the SFR has poor water quality for drinking and 39% agree the SFR has poor
water quality for swimming. Yet, 84% consider the river safe enough for picnics and
activities near the water. Also, it was interesting to note participants’ opinions regarding
74
consequences of poor water quality with 66% of respondents indicating that they are
concerned with poor water quality and their health. This is particularly surprising since
individuals do not feel that their current activities constitute any added risk to their
health, yet their responses indicted that they believe water quality in the SFR is poor.
Individuals’ perceptions are shaped by beliefs about how others in their community
perceive the risks (Morua et al, 2011). Therefore, the responses may not be providing a
clear answer if the participants are establishing their responses to what they believe the
rest of their community feels. As previously mentioned, Clifton is a very tight knit
community so it was not unexpected that the majority of the respondents (61%) get water
quality information by having conversations with other people and 68% from
newspapers, factsheets and brochures. This information is particularly important for
benefiting Cooperative Extension outreach efforts in this community.
Of the respondents, our target audience, Hispanics, was recorded as the least involved for
a number of locally relevant reasons including mistrust of outside community groups and
lack of involvement in environmental issues. Future steps in this work in cooperation
with ADEQ, GWP, and the University of Arizona, will be to use survey information to
inform minority groups such as Mexican Americans and engage them about local
environmental issues and potential risks. To successfully engage Hispanic audiences,
particularly first- and second- generation individuals, programs must be culturally
responsive; in other words, the program must reflect cultural traditions, beliefs and values
of the people (Koss-Chiono & Vargas, 1999; Hobbs, 2004). Based on the survey
responses, our team worked to develop two peer reviewed Extension publications
75
entitled; Microbial Source Tracking: Watershed Characterization and Source
Identification (Arizona Cooperative Extension, #AZ1547) and Water Quality, E. coli, and
Your Health (#AZ1624). Publications have been developed in both English and Spanish
and will be part of future outreach to this and other Arizona communities. This
information transfer media ranked the highest in trusted resources among survey
respondents and will aid in information dissemination to the targeted population.
Additionally, because connections between poor water quality and human health
consequences seemed to indicate low science/health literacy, outreach activities will aim
to educate the community about water quality and human health. Basic principles of
disease, sanitation, at-home impacts on environmental health, point source and non-point
source pollution, and how to prevent illness within the community will be the main
themes, workshops or outreach events. It is our goal that these survey findings can be
used to better tailor outputs appropriate for the targeted audience, namely the local
Hispanic population. Our findings, although limited due to low level of participation,
overall, add to the understanding perceptions of water quality and health risks in this rural
community and can lend towards enhance outreach practices in other similar
communities.
76
References
American Public Health Association, American Water Works Association, and Water
Environment Federation. (1998). Standard Methods for the Examination of Water
and Wastewater 20th Edition. Eds. Clesceri, L. S., Greenberg, A. E. and Eaton,
A. D. United Book Press Inc, Baltimore, MD.
Armstrong, A., Stedman, R. C., Bishop, J. A., & Sullivan, P. J. (2012). What’s a Stream
Without Water? Disproportionality in Headwater Regions Impacting Water
Quality. Journal of Environmental Management, 50: 849-860.
Arizona Department of Environmental Quality. (2012). Watershed Improvement Plan
San Francisco and Blue Rivers. [On-line]. Available at:
http://lists.azdeq.gov/environ/water/watershed/download/san_fran_blue-wip.pdf
Cervantes, O., Espejel, I., Arellano, E., & Delhumeau, S. (2008). Users’ Perception as a
Tool to Improve Urban Beach Planning and Management. Journal of
Environmental Management, 42: 249-264.
Coburn, J., & Donaldson, S. (1997). Reaching a New Audience. Journal of Extension
[On-Line], 35(1) Article 1FEA3. Available at:
http://www.joe.org/joe/1997february/a3.php
Hobbs, B. B. (2004). Latino Outreach Programs: Why They need to be Different. [OnLine], 42(1). Available at: http://www.joe.org/joe/2004august/comm1.php
Koss-Chioino, J. & Vargas, L. (1999). Working with Latino youth: Culture, development,
and context. San Francisco: Jossey-Bass Publishers.
Layton, A., McKay, L., Williams, D., Garrett, V., Gentry, R., & Sayler, G. (2006).
Development of Bacteroides 16S rRNA Gene TaqMan-Based Real-Time PCR
Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water.
Journal of Applied and Environmental Microbiology, 72: 4214-4224.
Morua, A. R., Halvorsen, K. E., & Mayer, A. S. (2011). Waterborne Disease-Related
Risk Perception in the Sonora River Basin, Mexico. Journal of Risk Analysis,
31: 866-878.
Prokopy, L. S., Molloy, A., Thompson, A., & Emmert, D. (2010). Assessing Awareness
of Water Quality: Comparing Convenience and Random Samples. Journal of
Extension [On-Line], 48(3) Article 3FEA2. Available at:
http://www.joe.org/joe/2010june/a2.php
Kaiser, F. G., Wolfing, S., & Fuhrer, U. (1999). Environmental Attitude and Ecological
Behaviour. Journal of Environmental Psycology, 19: 1-19.
77
Rivera, B. and Rock, C. (2011). Microbial Source Tracking: Watershed Characterization
and Source Identification. Arizona Cooperative Extension [On-Line], AZ1547.
Available at: http://cals.arizona.edu/pubs/water/az1547.pdf
Rivera, B. and Rock, C. (2014). Water Quality, E. coli, and Your Health. Arizona
Cooperative Extension, AZ1624.
Seurinck, S., Defoirdt, T., Vestraete, W., & Siciliano, S. D. (2004). Detection and
quantification of the human-specific HF183 Bacteroides 16S rRNA genetic
marker with real-time PCR for assessment of human faecal pollution in
freshwater. Journal of Environmental Microbiology, 7: 249-259.
Shanks, O. C., Atikovic, E., Blackwood, A. D., Noble, R. T., Santo Domingo, J.,
Seifring, S.,Sivaganesan, M., & Haugland, R. A. 2008. Quantitative PCR for
genetic markers of cattle fecal pollution. Journal of Applied and Environmental
Microbiology, 74: 745-752.
Taylor-Clark, K., Koh, H., & Viswanath, K. (2007). Perceptions of Environmental
Health Risks and Communication Barriers among Low-SEP and Racial/Ethnic
Minority Communities. Journal of Health Care for the Poor and Underserved,
18: 165–183.
U.S. Environmental Protection Agency. (2002). Community culture and the
Environment: A Guide to Understanding a Sense of Place. US EPA Washington,
D.C.
U.S. Environmental Protection Agency. (2003). Getting in Step: A Guide for Conducting
Watershed Outreach Campaigns. US EPA Washington, D.C.
78
APPENDIX C
MICROBIAL SOURCE TRACKING: WATERSHED CHARACTERIZATION
AND SOURCE IDENTIFICATION
(Published in Arizona Cooperative Extension)
Berenise Rivera, MPH, PhD Student, Soil/Water and Environmental Science
Dr. Channah Rock, Extension Water Quality Specialist/Assistant Professor, Soil/Water
and Environmental Science
Water Quality and Fecal Contamination.
Water quality has been a concern for numerous stakeholders and has been monitored for
many decades; in particular since the enactment of the Clean Water Act in 1972.
However, more than 30 years after the Clean Water Act was implemented, a significant
fraction of US rivers, lakes, and estuaries continue to be classified as failing to meet their
designated uses due to high levels of fecal bacteria (US EPA 2005). As a consequence,
protection from fecal contamination and bacteria is one of the most important and
difficult challenges facing environmental scientists, regulators, and communities trying to
safeguard public water supplies as well as waters used for recreation (primary and
secondary contact). Traditional water quality monitoring has helped improve water
sanitation to protect public health but also led to economic losses due to closures of
recreational beaches and surface waters. Additionally, solutions to contamination are not
always readily apparent and easily identifiable. The ability to discriminate between
79
sources of fecal contamination is necessary for a more defined evaluation of human
health risks and to make waters safe for human use.
The potential sources of fecal contamination causing these impairments can be classified
into two groups: point sources that are easily identifiable (e.g., raw and treated sewage
and combined sewer overflows) and non-point sources that are diffuse in the environment
and may be difficult to identify (e.g., agriculture, forestry, wild-life, and urban runoff)
(Okabe et al. 2007). Understanding the origin of fecal contamination is paramount in
assessing associated health risks as well as identifying the actions necessary to remedy
the problem (Scott et al. 2002). As a result, numerous methods have been developed to
identify fecal contamination as well as differentiate between these sources of pollution.
Accurately identifying these sources can help to facilitate the elimination of waterborne
microbial disease as a leading threat to public health (Simpson, Santo Domingo and
Reasoner 2002) (Figure 1).
Fecal coliform & Escherichia coli.
Indicator bacteria are used to predict the presence/absence or minimize the potential risk
associated with pathogenic microorganisms (Scott et al. 2002). Fecal coliform are a
group of bacteria that originate in the feces of mammals and include the genera
Escherichia and Klebsiella (Figure 2). These indicator bacteria are identified in the
laboratory using certain tests to evaluate their ability to use lactose as a food source.
Escherichia coli or E.coli are fecal coliform bacteria that have been extensively used to
indicate the presence of human pathogens in water (Parveen et al. 2001). A pathogen is
80
defined as a microorganism that has the potential to make a healthy individual sick.
Methods such as the IDEXX Colilert and Colisure (IDEXX Laboratories Inc., Westwood,
Maine) have been widely used by municipalities, regulatory agencies, researchers, and
volunteers to evaluate the health and safety of water. These methods work by estimating
the concentration or amount of E.coli in a water sample that is able to grow and produce a
color change using specified media (Figure 3). E.coli are widely used as indicators of
fecal contamination due to the fact that cultivation and detection methods are relatively
inexpensive, little training is needed to perform tests, and their presence may indicate the
presence of pathogens. Due to the many health risks E. coli presence can pose, entities
such as the US EPA and State Departments of Environmental Quality (DEQ) have
implemented ways to assess and regulate waters containing E.coli. Regulatory levels of
E.coli have been establish to determine if a water is suitable for partial or full body
contact based on an acceptable human health risk. According to the US EPA, partialbody contact (PBC) means the recreational use of surface water that may cause the
human body to come into direct contact with the water, but normally not to the point of
complete submergence. The use is such that ingestion of the water is not likely and
sensitive body organs, such as the eyes, ears, or nose, will not normally be exposed to
direct contact with the water. Full-body contact (FBC) means the use of surface water for
swimming or other recreational activity that causes the human body to come into direct
contact with the water to the point of complete submergence. The use is such that
ingestion of the water is likely and sensitive body organs, such as the eyes, ears, or nose,
may be exposed to direct contact with the water. Numerous epidemiology studies have
81
been conducted worldwide to evaluate the association between recreational water quality
and adverse health outcomes including gastrointestinal (GI) symptoms, eye infections,
skin irritations, ear, nose and throat infections and respiratory illness, and have indicated
that the rates of some adverse health outcomes are higher in swimmers compared with
non-swimmers (Soller et al. 2010). Concentrations of E.coli cannot exceed 575 Colony
Forming Units (CFU) per 100 mL for partial body contact (PBC) while full body contact
(FBC) cannot exceed 235 CFU per 100 mL for human health protection and regulatory
purposes. This regulatory value for FBC equates to the acceptable risk of approximately 8
cases of gastrointestinal illness (diarrhea) per 1000 swimmers per year (US EPA 2009).
Although the presence of E.coli in water indicates the presence of fecal contamination
and potential pathogens, it has been established that most warm-blooded animals can
release fecal coliform bacteria and E.coli to a body of water (Buchan, Alber and Hodson
2001). Consequently, the presence of E. coli in water is not specific to human sources of
pollution. Fecal coliform bacteria are found in both human and animal feces and thus,
may present a unique tool for tracking sources or contamination. Tracking and
monitoring the source of contamination is critical for problem identification and
remediation (Fong, Griffin and Lipp 2005). The most widely used method for measuring
fecal pollution is to quantify viable fecal coliform bacteria by culturing them. However,
culture based methods do not identify the source of fecal contamination (Field and
Bernhard 2000).
82
What is Microbial Source Tracking?
Microbial Source Tracking (MST) methods are intended to discriminate between human
and non-human sources of fecal contamination, and some methods are designed to
differentiate between fecal contamination originating from individual animal species
(Griffith, Weisberg and McGee 2003). MST is an active area of research with the
potential to provide important information to effectively manage water resources
(Stoeckel et al. 2004).
MST methods are typically divided into two categories. The first category is called
library-dependent, relying on isolate-by-isolate identification of bacteria cultured from
various fecal sources and water samples and comparing them to a “library” of bacterial
strains from known fecal sources. Library-dependent methods require the development of
biochemical (phenotypic) or molecular (genotypic) fingerprints for bacterial strains
isolated from suspected fecal sources (US EPA 2005). These fingerprints are then
compared to developed libraries for classification. The use of fecal bacteria to determine
the host animal source of fecal contamination is based on the assumption that certain
strains of fecal bacteria are associated with specific host animals and that strains from
different host animals can be differentiated based on phenotypic or genotypic markers
(Layton et al. 2006). Library-dependent methods tend to be more expensive and require
more time and experienced personnel completing the analysis due to the time it takes to
develop a library (Figure 4). Additionally, one of the major disadvantages to librarydependent methods is that libraries tend to be temporally and geographically specific.
83
While this can be useful for a specific location, they are generally not as applicable on a
broader watershed scale or on statewide issues.
The second category is called library-independent, and is based on the detection of a
specific host associated genetic marker or gene target identified in the molecular material
isolated from a water sample. These methods can help identify sources based on a known
host-specific characteristic (genetic marker) of the bacteria without the need of a
“library”. One of the most widely used library-independent approaches utilizes
polymerase chain reaction (PCR) to amplify a gene target that is specifically found in a
host population (Shanks et al. 2010). PCR enables researchers to screen genetic material
from bacteria (e.g., deoxyribonucleic acid [DNA] or ribonucleic acid [RNA]) isolated
from a water sample for a specific sequence or target in relatively short amount of time
(Figure 5). These methods do not depend on the isolation of DNA directly from the
original source, although some methods often require a pre-enrichment to increase the
sensitivity of the approach (US EPA 2005).
What MST methods are currently being used?
Recently there has been an effort to better understand the various types of MST methods
available as well as which methods are most useful for the goals of source identification
and watershed characterization. According to the US EPA, while there has been
significant progress in the past 10 years towards method development; variability among
performance measurements and validation approaches in laboratory and field studies has
led to a body of literature that is very difficult to interpret (US EPA 2005). Comparison
84
studies have shown that no single method is clearly superior to the others (US EPA
2005). Therefore, no single method has emerged as the method of choice for determining
sources of fecal contamination in all fecal impaired water bodies. However, using the
appropriate method and appropriate indicator, sources of fecal contamination can be
found and characterized as to animal or human origin (Simpson, Santo Domingo and
Reasoner 2002). MST based on identification of specific molecular markers can provide
a more complete picture of the land uses and environmental health risks associated with
fecal pollution loading in a watershed than is currently possible with traditional indicators
and methods (Jenkins et al. 2009). MST methods have the ability to identify “who” is
contributing to the pollution whereas traditional culture based methods only tell you “if”
and “when” fecal contamination is present. The following table describes existing MST
methods that are currently being used and the general purposes for each (Table 1).
A recent review of the literature has identified an increase in library-independent methods
available for watershed characterization. In particular, host-specific bacterial and viral
PCR as well as host-specific quantitative PCR seem to have led recent method
development. In theory, host-specific PCR (library-independent MST) uses genetic
marker sequences that are not only specific to fecal bacteria, but are also specific to the
host species that produced the feces, allowing discrimination among different potential
sources (Field, Bernhard and Brodeur 2003). Host-specific PCR holds promise as an
effective method for characterizing a microbial population without first culturing the
organisms in question (Scott et al. 2002). Furthermore, these methods are cost effective,
rapid, and potentially more specific than library-dependent methods. It is anticipated that
85
these host-specific molecular methods will continue to develop with emphasis on those
methods using the quantitative polymerase chain reaction (qPCR) technique that
measures the amount of microbial DNA present in the water sample rather than simply
detecting a presence or absence of microbial DNA (Santo Domingo et al. 2007). By
quantifying the amount of microbial DNA, comparisons can be made regarding the
relative impacts of a specific source to a specific location within the watershed. In
particular, one of the most widely cited bacteria analyzed for library-independent MST is
Bacteroides.
What is Bacteroides?
The genus Bacteroides contains Gram negative, nonspore-forming, non-motile, anaerobic
rod bacteria generally isolated from the gastrointestinal tract (GI-tract) of humans and
animals (Smith, Rocha and Paster 2006). As members of the indigenous flora, they play a
variety of roles that contribute to normal intestinal physiology and function. These
include beneficial roles such as polysaccharide breakdown or nitrogen cycling (Smith,
Rocha and Paster 2006). According to Smith et al. (2006) Bacteroides generally cause
opportunistic infections that can occur any time the integrity of the mucosal wall of the
intestine is compromised such conditions are gastrointestinal surgery, perforated or
gangrenous appendicitis, perforated ulcer, diverticulitis, trauma and inflammatory bowel
disease. Another important aspect of Bacteroides biology is their lack in ability to
proliferate in the environment as well as their potential to survive in the environment at a
rate directly proportional to the pathogens of concern. Bacteroides depend primarily on
86
temperature and presence of predators, and have been found to survive for up to six days
under oxygen stressed conditions (Field and Dick 2004) similar to other pathogens.
Due to the abundance of this bacterium in human and animal feces, it has allowed for
host-related analysis targeting genes present in the Bacteroides genome. Layton et al.
(2006) states, bacteria belonging to the genus Bacteroides have been suggested as
alternative fecal indicator to E. coli or fecal coliform bacteria because they make up a
significant portion of the fecal bacteria population, have little potential for growth in the
environment, and have high degree of host specificity that likely reflects differences in
host animal digestive systems.
Numerous methodologies have been designed to target specific diagnostic sequences
within the Bacteroides 16S rRNA gene (which is vital for protein synthesis and therefore
present in all bacteria) present in feces from different animals. Katherine Field and
colleagues, in particular, have performed extensive research into the use of Bacteroides
16S rRNA-based PCR assays for MST. Field and Bernard (2004) developed 16S rRNA
gene makers from Bacteroides to detect fecal pollution and to distinguish between human
and ruminant (e.g., bovine, goat, sheep, deer, and others) sources by PCR. Developing
MST methods specific to molecular markers within the target gene will allow
differentiating between human and ruminant associated Bacteroides, therefore identifying
the possible source of contamination. As Scott et al. (2002) mentions, this approach offer
the advantage of circumventing the need for a culturing step, which allows a more rapid
identification of target organism.
87
While progress has been made in identifying genetic markers that are useful for MST,
few studies have evaluated how these molecular markers used as MST targets vary
temporally and spatially following fecal contamination of surface waters (Bower et al.
2005). There are several studies that have used MST methods; in particular hostassociated PCR-based assays targeting Bacteroides genetic markers to investigate the
sources and levels of fecal pollution in recreational water and watersheds. In a study
conducted by Gourmelon et al. (2007), three estuaries were compared by PCR using
human-specific Bacteroides markers in combination with human- and animal-specific
targets. PCR was found to be a reliable indicator of fecal contamination. Bacteroides was
observed in 95% of fecal samples in all sewage treatment plant and pig liquid manure. A
separate study targeting Bacteroides, Shanks et al. (2010), compared seven PCR and
qPCR assays targeting Bacteroides genes reported to be associated with either ruminant
or bovine feces. PCR indicated prevalence ranged from 54% to 85% for all DNA extracts
from 247 individual bovine fecal samples and specificity (how well the PCR assay
detected known bovine fecal samples) ranged from 76% to 100% for the assays studied.
A previous study by Griffith, Weisberg and McGee (2003), using blind samples
demonstrated that Bacteroides source-specific MST methods identified fecal sources
correctly when the sources comprised as little as 1% of the total fecal contamination in
the samples. While a wealth of knowledge exists in the literature, there are still many
ongoing MST studies targeting the 16S rRNA Bacteroides gene to improve detection and
watershed characterization.
88
Although Bacteroides MST has been useful for pollution characterization, it is still an
emerging science and research is currently being done to validate publish methods and
better understand the effectiveness of available technologies. Extensive field testing is
ongoing to determine the efficacy of published assays and the geographic distributions of
presumptively human-specific markers (McLain et al. 2009). Several recent studies have
described testing of feces from domestic animals, livestock, bird and mammal wildlife as
well as fish and other aquatic species for cross amplification with human assays and
molecular markers previously thought to be human specific (McLain et al. 2009).
Therefore, it is critical that MST based methods be evaluated on a watershed by
watershed basis to ultimately understand the utility of the methods for accurate pollution
characterization.
MST Supporting Watershed Characterization and Source Identification in Arizona.
The Arizona Department of Environmental Quality (ADEQ) was established by the
Arizona Legislature in 1986. ADEQ’s goal is to protect and enhance public health,
welfare, and the environment in Arizona. Today, ADEQ manages a variety of programs
to bring awareness of the water issues Arizona is currently facing. Also, ADEQ uses
programs to improve the welfare and health of Arizona’s citizens through ensuring that
water resources meet regulatory standards. This regulatory agency maintains a 303d list
of locations that do not meet clean water regulatory standards across the state of Arizona
(ADEQ 2010). Section 303d requires total maximum daily loads (TMDL) be established
for the impaired waters by states, territories, and authorized tribes with oversight by the
89
US EPA (Simpson, Santo Domingo and Reasoner 2002). A TMDL is defined as the
maximum amount of a pollutant the water body can receive and still meet regulated limits
for that pollutant. As of 2008, ADEQ listed 17 impaired watersheds throughout the state
of Arizona on the 303d list due to E. coli presence higher than the set standards (US EPA
2008). It is anticipated that the number of impaired watersheds will increase by the year
2012. ADEQ works diligently to bring those impaired watersheds to standard.
Recently, an approach used by the ADEQ section tasked with TMDL implementation has
involved intensive water quality monitoring by trained volunteers coupled with the use of
innovative MST methods. This approach aims to better understand and outline the
courses of action necessary to restore impaired waters and to protect and maintain
unimpaired waters across the State of Arizona. As part of this approach, local stakeholder
driven watershed groups and the State agency have begun to collaborate with research
institutions, the University of Arizona and Northern Arizona University, to utilize MST
techniques to identify sources of fecal bacteria and microbial contamination within
impaired watersheds. The objective of this approach is to identify and appropriately
characterize the pollutant sources causing the impairments. In watersheds where sources
are not known or understood, MST techniques can help to identify and also eliminate
potential sources of fecal bacteria.
To date, over 181 surface water samples have been collected by volunteers trained by
faculty, staff and students from the University of Arizona Cooperative Extension in three
watersheds currently classified as impaired for E.coli bacteria by ADEQ (Figures 6, 7 and
90
8). Research at the University of Arizona is underway to evaluate currently published
MST methods that produce reliable data from these watersheds for TMDL development
and implementation. MST methods were specifically chosen within these select regions
in the State due to the anticipated source(s) of bacteria not visibly obvious in these
watersheds. More specifically, methods were selected to differentiate between Human
and Bovine sources of Bacteroides present in volunteer collected water samples. Each of
the different watersheds included in this study has different land-use characterization
(urban vs. rural) and potential inputs within their area. Using the methods mentioned
above to identify the sources of fecal pollution will empower ADEQ to work with
stakeholders within the community to monitor and remediate locations contributing to
contamination with the ultimate intent to de-list impaired waters of Arizona.
91
References
Arizona Department of Environmental Quality. 2010 Water Quality [Online]
http://www.azdeq.gov/environ/water/index.html.
Bower, P. A., Scopel, C. O., Jensen, E. T., Depas, M. M., and McLellan, S. L. 2005.
Detection of Genetic Markers of Fecal Indicator Bacteria in Lake Michigan and
Determination of Their Relationship to Escherichia coli Densities Using Standard
Microbiological Methods. Appl. Environ. Microbiol. 71(12): 8305-8313.
Buchan, A., Alber, M., and Hodson, R. E. 2001. Strain-specific differentiation of
environmental Escherichia coli isolates via denaturing gradient gel electrophoresis
(DGGE) analysis of the 16S-23S intergenetic spacer region. FEMS Microbiol.
Ecol. 35: 313-321.
Field, K. G., and Bernhard, A. E. 2000. Identification of Nonpoint Sources of Fecal
Pollution in Coastal Waters by Using Host-Specific 16S Ribosomal DNA Genetic
Markers from Fecal Anaerobes. Appl. Environ. Microbiol. 66: 1587-1594.
Field, K. G., Bernhard, A. E., and Brodeur, T. J. 2003. Molecular Approaches To
Microbiological Monitoring: Fecal Source Detection. Environ. Monitoring and
Assessment 81: 313-326.
Field, K. G., and Dick, L. K. 2004. Rapid Estimation of Numbers of Fecal Bacteroidetes
by use of a Quantitative PCR Assay for 16S rRNA Genes. Appl. Environ.
Microbiol. 70: 5695- 5697.
Fong, T. T., Griffin, D. W., and Lipp, E. K. 2005. Molecular Assays for Targeting
Human and Bovine Enteric Viruses in Coastal Waters and their Application for
Library-Independent Source Tracking. Appl. Environ. Microbiol. 71: 2070-2078.
Gourmelon, M., Caprais, M. P., Segura, R., Le Mennec, C., Lozach, S., Piriou, J. Y., and
Rince, A. 2007. Evaluation of Two Library-Independent Microbial Source
Tracking Methods To Identify Sources of Fecal Contamination in French
Estuaries. Appl. Environ. Microbiol. 73: 4857-4866.
Griffith, J. F., Weisberg, S. B., and McGee, C. D. 2003. Evaluation of microbial source
tracking methods using mixed fecal sources in aqueous test samples. J. Wat.
Health 1: 141-151.
Jenkins, M. W., Sangam, T., Lorente, M., Gichaba, C. M., and Wuertz, S. 2009.
Identifying human and livestock sources of fecal contamination in Kenya with
host-specific Bacteroidales assay. Water Research 43: 4956-4966.
92
Layton, A., McKay, L., Williams, D., Garrett, V., Gentry, R., and Sayler, G. 2006.
Development of Bacteroides 16S rRNA Gene TaqMan-Based Real-Time PCR
Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water.
Appl. Environ. Microbiol. 72: 4214-4224.
McLain, J. E., Ryu, H., Kabiri-Badr, L., Rock, C. M., and Abbaszadegan, M. 2009. Lack
of specificity for PCR assays targeting human Bacteroides 16S rRNA gene: crossamplification with fish feces. FEMS Microbiology Letters 299: 38-43.
Okabe, S., Okayama N., Savichtcheva O., and Ito, T. 2007. Quantification of hostspecific Bacteroides–Prevotella 16SrRNA genetic markers for assessment of fecal
pollution in freshwater. Appl. Microbiol. Biotechnol. 74: 890-901.
Parveen, S., Hodge, N. C., Stall, R. E., Farrah, S. R., and Tamplin, M. L. 2001
Phenotypic and Genotypic Characterization of Human and Nonhuman
Escherichia coli. Water Res. 35: 379-386.
Santo Domingo, J. W., Bambic, D. G., Edge, T. A., and Wuertz, S. 2007. Quo Vadis
Source Tracking? Towards a Strategic Framework for Environmental Monitoring
of Fecal Pollution. Water Res. 41: 3539-3552.
Scott, T. M., Rose, J. B., Jenkins, T. M., Farrah, S. R., and Lukasik, J. 2002. Microbial
Source Tracking: Current Methodology and Future Directions. Appl. Environ.
Microbiol. 68: 5796-5803.
Shanks, O. C., White, K., Kelty, C. A., Hayes, S., Sivaganesan, M., Jenkins, M., Varma,
M., and Haugland, R. A. 2010. Performance Assessment PCR-Based Assays
Targeting Bacteroidales Genetic Markers of Bovine Fecal Pollution. Appl.
Environ. Microbiol. 76: 1359-1366.
Simpson, J. M., Santo Domingo, J. W., and Reasoner, D. J. 2002. Microbial Source
Tracking: State of the Science. Environ. Sci. Technol. 36: 5279-5288.
Smith, C. J., Rocha, E. R., and Paster, B. J. 2006. The Medically Important Bacteroides
spp. in Health and Disease. Prokaryotes 7: 381-427.
Soller, J. A, Schoen, M. E., Bartrand, T., Ravenscroft, J. E., and Ashbolt, N. J. 2010.
Estimated human health risks from exposure to recreational waters impacted by
human and non-human sources of faecal contamination. Water Research 30: 1-18.
Stoeckel, D. M., Mathes, M. V., Hyer, K. E., Hagedorn, C., Kator, H., Lukasik, J.,
O’Brien, T. L., Fenger, T. W., Samadpour, M., Strickler, K. M., and Wiggins, B.
A. 2004. Comparison of Seven Protocols To Identify Fecal Contamination
Sources Using Escherichia coli. Environ. Sci. Technol. 38: 6109-6117.
93
US Environmental Protection Agency. 2005. Microbial source tracking guide. Document
EPA/600/R-05/064. U. S. Environmental Protection Agency, Washington, DC.
US Environmental Protection Agency. 2008. Arizona 2008 Water Quality Assessment
Report [Online]
http://iaspub.epa.gov/waters10/attains_index.control?p_area=AZ#wqs
US Environmental Protection Agency. 2009. Water Quality Standards [Online]
http://www.epa.gov/waterscience/standards/wqslibrary/az/az_9_wqs.pdf
US Environmental Protection Agency, Region 10. 2011. Using Microbial Source
Tracking to Support TMDL Development and Implementation [Online]
http://www.epa.gov/region10/pdf/tmdl/mst_for_tmdls_guide_04_22_11.pdf
94
Tables
Table 1. Common Types of MST Methods (ref: US EPA 2011)
Library-dependent
Library-independent
Culture-dependent
Biochemical
 Antibiotic
resistance
 Carbon utilization
Molecular
 Rep-PCR
 PFGE
 Ribotyping
Culture-independent
Biochemical or
Molecular
 Bacteriophage
 Bacterial culture
Molecular
 Host-specific bacterial PCR
 Host-specific viral PCR
 Host-specific quantitative
PCR
95
Table 2. Commonly Used Terms (ref. US EPA 2011)
Commonly Used Terms:
Biochemical (aka phenotypic) methods refer to the ability to physically observe a
characteristic of the isolated bacteria that might have been acquired from exposure to different
host species or environment. Examples may be the resistance to certain antibiotic or utilization
of carbon or nutrient source.
Culture-dependent methods rely on bacteria from water samples being grown or cultured in a
lab.
Colony Forming Units (CFU) refers to the unit of measure or the concentration of cultured
bacteria.
Culture-independent methods isolate and identify DNA directly from a water sample without
first having to grow or culture the bacteria from the sample.
Fecal Source refers to a human or animal host where a microbe originates in the fecal waste of
that host. Depending on the specificity of an MST method, a fecal source might refer to a
general group of hosts (e.g., all humans, all animals, or a group of animals such as ruminants),
or a specific animal host (e.g., cattle, elk, dogs, etc.).
Library-dependent methods identify fecal sources from water samples based on databases of
genotypic of phenotypic fingerprints for bacteria strains of know fecal sources.
Library-independent methods identify fecal sources based on known host-specific
characteristics of the bacteria without the need of a library.
Microbial Source Tracking (MST) refers to a group of methods intended to discriminate
between human and non-human sources of fecal contamination. Some methods are designed to
differentiate between fecal contamination originating from individual animal species.
Microbial Strain is a genetic variant or subtype of a microorganism (e.g., bacterial species).
Molecular (aka genotypic) methods utilize variations in the genetic makeup or the DNA of
each individual organism or bacteria. This is often referred to as “DNA fingerprinting”.
96
Images/Figures
Figure 1. Waterborne transmission of pathogens.
97
Total
Coliform
Bacteria
Fecal
Coliform
Bacteria
E. coli
Pathogens
Figure 2. Relationship between indicators and pathogens.
98
Figure 3. Visualization of a fecal contaminated water sample; cells fluorescing blue
indicate the presence of E.coli in the water.
99
Figure 4. PhD student, Berenise Rivera, demonstrates sterile technique while assaying
water samples for fecal bacteria.
100
Figure 5. DNA Extraction/Concentration.
101
Figure 6. Volunteer water quality monitoring team receives training from UA
Cooperative Extension.
102
Figure 7. Volunteer water quality monitoring in the Santa Cruz River, AZ.
103
Figure 8. Environmental water samples collected in the field.
104
APPENDIX D
SEGUIMIENTO DE ORIGEN MICROBIANO: CARACTERIZACIÓN DE
CUENCAS E IDENTIFICACIÓN DE ORIGEN
(Published in College of Agriculture and Life Sciences Cooperative Extension)
Berenise Rivera, MPH, Candidata a Doctorado, Suelo / Agua y Ciencias Ambientales
Dra. Channah Rock, Especialista en Calidad del Agua de extensión/ Profesor, Suelo /
Agua y Ciencias Ambientales
La Calidad del Agua y Contaminación fecal.
La calidad del agua es una preocupación para numerosos grupos de interés y ha sido
objeto de observación durante muchas décadas, en particular desde la promulgación de la
Ley de Agua Limpia de 1972. Sin embargo, más de 30 años después de que se puso en
práctica esta ley solo una fracción importante de los ríos, lagos y estuarios de Estados
Unidos siguen siendo clasificados por no cumplir con su categoría de uso debido a los
altos niveles de bacterias fecales (US EPA 2005). Como consecuencia, la protección
contra la contaminación fecal y de bacterias es uno de los retos más importantes y
difíciles que enfrentan los científicos ambientales, reguladores, y comunidades que tratan
de proteger el suministro de agua pública, así como las aguas utilizadas para recreación
(contacto primario y secundario). El monitoreo tradicional de calidad del agua ha
ayudado a mejorar el saneamiento del agua para proteger la salud pública, pero también
dio lugar a pérdidas económicas debido a los cierres de áreas recreativas de playas, lagos
105
y ríos. Además, las soluciones a la contaminación no siempre son fácilmente evidentes o
identificables. La capacidad de discriminar entre las fuentes de contaminación fecal es
necesaria para poder hacer una evaluación más definida de los riesgos para la salud
humana y para poder hacer aguas seguras para uso humano.
Las fuentes potenciales de contaminación fecal que causan estos trastornos se pueden
clasificar en dos grupos: fuentes puntuales que son fácilmente identificables (por
ejemplo, las aguas residuales crudas y tratadas y derrames de aguas negras combinadas) y
las fuentes no puntuales que están difusas en el ambiente y pueden ser difíciles de
identificar (por ejemplo, la agricultura, la silvicultura, la vida silvestre, y la escorrentía
urbana) (Okabe et al. 2007). Comprender el origen de la contaminación fecal es de suma
importancia en la evaluación de riesgos para la salud, así como la identificación de las
acciones necesarias para solucionar el problema (Scott et al. 2002). Como resultado,
numerosos métodos se han desarrollado para identificar la contaminación fecal, así como
diferenciar entre estas fuentes de contaminación. La identificación precisa de estas
fuentes puede ayudar a facilitar la eliminación de las enfermedades microbianas
transmitidas por el agua como una amenaza principal para la salud pública (Simpson,
Santo Domingo y Reasoner 2002) (Figura 1).
Coliformes fecales y Escherichia coli.
Bacterias indicadoras se utilizan para indicar la presencia / ausencia o reducir el riesgo
potencial asociado con microorganismos patógenos (Scott et al. 2002). Los coliformes
106
fecales son un grupo de bacterias que se originan en las heces de mamíferos e incluyen
los géneros Escherichia y Klebsiella (Figura 2). Estas bacterias indicadoras se identifican
en el laboratorio con el uso de ciertas pruebas para evaluar su capacidad para utilizar
lactosa como fuente de alimento. Escherichia coli o E.coli son bacterias coliformes
fecales que se han utilizado extensivamente para indicar la presencia de patógenos
humanos en agua (Parveen et al. 2001). Un patógeno se define como un microorganismo
que tiene el potencial de hacer que un individuo sano se enferme. Métodos como el
IDEXX Colilert y Colisure (IDEXX Laboratories Inc., Westwood, Maine) han sido
ampliamente utilizados por los municipios, agencias reguladoras, investigadores y
voluntarios para evaluar la salud y seguridad del agua. Estos métodos funcionan mediante
la estimación de la concentración o cantidad de E. coli en una muestra de agua que es
capaz de crecer y producir un cambio de color utilizando medios específicos (Figura 3).
E.coli son ampliamente utilizados como indicadores de contaminación fecal, debido al
hecho de que los métodos de cultivo y detección son relativamente baratos, se necesita
poco entrenamiento para llevar a cabo las pruebas, y su presencia puede indicar la
presencia de patógenos. Debido a los muchos riesgos de salud que la presencia de E. coli
puede plantear, entidades como la Agencia de Protección Ambiental (EPA) de los E.U. y
el Departamento Estatal de Calidad Ambiental (DEQ) han puesto en práctica métodos
para evaluar y regular el uso de aguas que contienen E. coli. Niveles reglamentarios de E.
coli se han establecido para determinar si el agua es adecuada para el contacto parcial o
total del cuerpo sobre la base de un riesgo aceptable para la salud humana. De acuerdo
con el EPA de los E. U., el contacto corporal parcial (CCP) significa el uso recreativo de
107
las aguas superficiales que pueden causar que el cuerpo humano entre en contacto directo
con el agua, pero por lo general no hasta el punto de inmersión completa. El uso es tal
que la ingestión del agua no es probable y órganos más sensibles del cuerpo, como los
ojos, las orejas o la nariz, no estará expuesto al contacto directo con el agua. Contacto
corporal completo (CCC) significa el uso de las aguas superficiales para nadar u otra
actividad recreativa que hace que el cuerpo humano entre en contacto directo con el agua
hasta el punto de inmersión completa. El uso es tal que la ingestión de agua es probable y
órganos del cuerpo sensibles, tales como los ojos, los oídos o la nariz, puede estar
expuesto a contacto directo con el agua. Numerosos estudios epidemiológicos se han
llevado a cabo en todo el mundo para evaluar la asociación entre la calidad de las aguas
recreativas y los resultados adversos de salud, incluyendo síntomas gastrointestinales
(GI), infecciones oculares, irritaciones de la piel, oído, nariz y garganta, infecciones y
enfermedades respiratorias, y han indicado que las tasas de algunos resultados adversos
de salud son más altos en nadadores en comparación con los no nadadores (Soller et al.
2010). Las concentraciones de E. coli no puede exceder 575 unidades formadoras de
colonias (UFC) por 100 ml para el contacto corporal parcial (CCP), mientras que el
contacto corporal completo (CCC) no puede exceder de 235 UFC por 100 ml a efectos de
regulación y protección de la salud humana. Este valor normativo de CCC equivale al
riesgo aceptable de aproximadamente 8 casos de enfermedad gastrointestinal (diarrea)
por 1.000 nadadores por año (US EPA 2009).
Aunque la presencia de E. coli en el agua indica la presencia de contaminación fecal y
patógenos potenciales, se ha establecido que la mayoría de los animales de sangre
108
caliente pueden liberar bacterias coliformes fecales y E. coli a un cuerpo de agua
(Buchan, Alber y Hodson 2001). En consecuencia, la presencia de E. coli en el agua no es
exclusiva de fuentes de contaminación humanas. Bacterias coliformes fecales se
encuentran en las heces humanas y animales, por lo tanto, pueden presentar una
herramienta única para las fuentes de contaminación o de seguimiento. El seguimiento y
control de la fuente de contaminación es crítica para la identificación de problemas y
remediación (Fong, Griffin y Lipp 2005). El método más utilizado para medir la
contaminación fecal es determinar la cantidad de bacterias coliformes fecales viables
mediante el cultivo de ellos. Sin embargo, los métodos basados en la cultura no
identifican la fuente de contaminación fecal (Field y Bernhard 2000).
¿Qué es el Seguimiento de Origen Microbiano?
Métodos de seguimiento de fuente microbiana (SFM) están destinados a discriminar entre
fuentes humanas y no humanas de contaminación fecal, y algunos métodos están
diseñados para diferenciar entre contaminación fecal procedentes de especies animales
individuales (Griffith, Weisberg y McGee 2003). SFM es un área activa de investigación
con el potencial de proporcionar información importante para gestionar eficazmente los
recursos hidráulicos (Stoeckel et al. 2004).
Los métodos SFM suelen dividirse en dos categorías. La primera categoría es llamada
biblioteca- dependiente, basándose en aislar-por-aislar la identificación de las bacterias
cultivadas a partir de diversas fuentes fecales y muestras de agua y compararlas con una
"biblioteca" de cepas bacterianas a partir de fuentes conocidas fecales. Métodos de
109
biblioteca-dependientes requieren el desarrollo de las huellas dactilares bioquímicos
(fenotípica) o moleculares (genotípica) para las cepas bacterianas aisladas de presuntas
fuentes fecales (US EPA 2005). Estas huellas son comparadas en las bibliotecas
desarrolladas para la clasificación. El uso de bacterias fecales para determinar el origen
animal huésped de contaminación fecal se basa en la suposición de que ciertas cepas de
bacterias fecales se asocian con animales hospederos específicos y que las cepas de
diferentes animales huésped pueden ser diferenciados en base a marcadores fenotípicos o
genotípicos (Layton et al. 2006). Los métodos de biblioteca-dependientes tienden a ser
más costosos y requieren más tiempo y personal con experiencia para completar el
análisis debido al tiempo que se necesita para desarrollar una biblioteca (Figura 4).
Además, una de las principales desventajas de los métodos de biblioteca-dependiente es
que las bibliotecas tienden a ser temporal y geográficamente específicas. Mientras que
esto puede ser útil para un lugar específico, por lo general no son muy aplicables a
escalas más amplias como al nivel de una cuenca o estatal.
La segunda categoría es llamada biblioteca-independiente, y se basa en la detección de un
marcador genético asociado con un hospedero específico o sea un gen identificado en el
material molecular aislado de una muestra de agua. Estos métodos pueden ayudar a
identificar las fuentes de contaminación basadas en una característica conocida del
huésped específico (marcador genético) de la bacteria sin la necesidad de una
"biblioteca". Uno de los enfoques más ampliamente utilizados de los métodos bibliotecaindependientes es utilizar una reacción en cadena de la polimerasa (PCR) para amplificar
un gen diana que se encuentra específicamente en una población huésped (Shanks et al.
110
2010). PCR permite a los investigadores detectar material genético de las bacterias (por
ejemplo, ácido desoxirribonucleico [ADN] o ácido ribonucleico [ARN]) aislado de una
muestra de agua para una secuencia diana específica o en período relativamente corto de
tiempo (Figura 5). Estos métodos no dependen del aislamiento de ADN directamente de
la fuente original, aunque algunos de estos métodos a menudo requieren un preenriquecimiento para aumentar la sensibilidad del método (US EPA 2005).
¿Qué métodos del SFM se están utilizando en la actualidad?
Recientemente ha habido un fuerte interés en comprender mejor los diversos tipos de
métodos de SFM disponibles, así como cuales métodos son más útiles para los objetivos
de identificación de la fuente y la caracterización de cuencas. De acuerdo con la EPA de
los E. U., mientras que ha habido un progreso significativo en los últimos 10 años hacia
el desarrollo de métodos; desafortunadamente variabilidad de las mediciones de
rendimiento y métodos de validación de los estudios de laboratorio y de campo ha dado
lugar a un cuerpo de literatura que es muy difícil de interpretar (US EPA 2005). Estudios
comparativos han demostrado que ningún método es claramente superior a los otros (US
EPA 2005). Por lo tanto, ningún método ha surgido como el método preferido para la
determinación de las fuentes de contaminación fecal en todos los cuerpos de agua
fecalmente deteriorados. Sin embargo, usando el método e indicador apropiado, las
fuentes de contaminación fecal se pueden encontrar y caracterizar en cuanto a origen
animal o humano (Simpson, Santo Domingo y Reasoner 2002). El SFM basado en la
identificación de marcadores moleculares específicos puede proporcionar una imagen
111
más completa de los usos del suelo y los riesgos ambientales para la salud asociados con
la carga de contaminación fecal en una cuenca de lo que actualmente es posible con los
indicadores y los métodos tradicionales (Jenkins et al. 2009). Los métodos SFM tienen la
capacidad de identificar "quién" está contribuyendo a la contaminación, mientras que los
métodos tradicionales basados en cultivos sólo te dicen "si" y "cuándo" la contaminación
fecal está presente. En la siguiente tabla se describen los métodos SFM existentes que se
están utilizando actualmente y los objetivos generales para cada uno (Tabla 1).
Una reciente revisión de literatura ha identificado un aumento en los métodos de
biblioteca-independientes disponibles para la caracterización de las cuencas
hidrográficas. En particular, PCR bacteriana y viral de huésped específico, así como PCR
cuantitativa de huésped específico parecen haber conducido el reciente desarrollo de
métodos. En teoría, la PCR huésped específico (biblioteca-independiente SFM) utiliza
secuencias marcadoras genéticas que no sólo son específicos para las bacterias fecales,
pero también son específicos de la especie huésped que producen las heces, lo que
permite la discriminación entre las diferentes fuentes potenciales (Field, Bernhard y
Brodeur 2003). PCR específico del huésped promete ser un método eficaz para la
caracterización de una población microbiana sin cultivar los organismos en cuestión
(Scott et al. 2002). Además, estos métodos son rentables, rápidos, y potencialmente más
específico que los métodos de biblioteca-dependientes. Se espera que estos métodos
moleculares específicos del huésped continuarán desarrollándose con énfasis en los
métodos que utilizan la reacción en cadena de la polimerasa cuantitativa (qPCR), el cual
es una técnica que mide la cantidad de ADN microbiana presente en la muestra de agua
112
en lugar de simplemente detectar la presencia o ausencia de ADN microbiano (Santo
Domingo et al. 2007). Al cuantificar la cantidad de ADN microbiano se pueden hacer
comparaciones con respecto a los impactos relativos de una fuente específica a una
ubicación específica dentro de la cuenca. En particular, una de las bacterias más citadas
analizadas para la biblioteca independiente de SFM es Bacteroides.
¿Qué es Bacteroides?
El género Bacteroides es anaeróbica e incluye bacteria Gram negativa, no forman
esporas, son inmóviles, en forma de vara y generalmente son aisladas del tracto
gastrointestinal (tracto GI) de los humanos y animales (Smith, Rocha y Paster 2006).
Como miembros de la flora nativa desempeñan una variedad de funciones que
contribuyen a la fisiología intestinal y función normal. Estos incluyen funciones
benéficas como la disolución de polisacáridos o ciclo del Nitrógeno (Smith, Rocha y
Paster 2006). De acuerdo con Smith et al. (2006) Bacteroides generalmente causan
infecciones oportunistas que pueden ocurrir en cualquier momento y la integridad de la
pared de la mucosa del intestino está comprometida. Tales condiciones son la cirugía
gastrointestinal, apendicitis perforada o gangrenosa, úlcera perforada, diverticulitis,
trauma y enfermedad inflamatoria del intestino. Otro aspecto importante de la biología de
Bacteroides es la falta de capacidad de proliferar en el medio ambiente, así como su
potencial para sobrevivir en el medio ambiente a una velocidad directamente
proporcional a los patógenos de interés. Bacteroides dependen principalmente de la
temperatura y la presencia de depredadores, y se ha encontrado que pueden sobrevivir
113
hasta seis días bajo condiciones de reducción de oxígeno (Field y Dick 2004) similar a
otros patógenos.
Debido a la abundancia de esta bacteria en las heces humanas y de animales, la bacteria
ha permitido para el análisis dirigido a los genes huésped presentes en el genoma
Bacteroides. Layton et al. (2006) expresa que las bacterias que pertenecen al género
Bacteroides se han sugerido como indicador fecal alternativo a E. coli o bacterias
coliformes fecales ya que constituyen una porción significativa de la población de
bacterias fecales, tienen poco potencial para el crecimiento en el medio ambiente, y
tienen alto grado de especificidad de huésped que probablemente refleja las diferencias
en los sistemas digestivos de origen animal de acogida.
Numerosos métodos han sido diseñados para secuencias diana específicas de diagnóstico
de Bacteroides dentro del gen 16S ARNr (que es vital para la síntesis de proteínas y por
lo tanto presente en todas las bacterias) presentes en las heces de diferentes animales.
Katherine Field y colegas, en particular, han realizado una amplia investigación sobre el
uso de Bacteroides 16S ARNr PCR ensayos basados en SFM. Field and Bernard (2004)
desarrollaron 16S ARNr genes responsables de Bacteroides para detectar la
contaminación fecal y distinguir entre recursos humanos y rumiantes (por ejemplo,
ganado bovino, caprino, ovino, venados, y otros) por PCR. El desarrollo de métodos SFM
específicos a los marcadores moleculares dentro del gen diana permitirá diferenciar entre
Bacteroides asociados con humanos y rumiantes, por lo tanto, ayudando con la
identificación de la posible fuente de contaminación. Como Scott et al. (2002) menciona,
114
este enfoque ofrece la ventaja de evitar la necesidad de una etapa de cultivo, lo que
permite una identificación más rápida del organismo.
Mientras que se ha avanzado en la identificación de marcadores genéticos que son útiles
para el SFM, pocos son los estudios que han evaluado cómo estos marcadores
moleculares utilizados como dianas de SFM varían en el tiempo y en el espacio después
de la contaminación fecal de las aguas superficiales (Bower et al. 2005). Hay varios
estudios que han utilizado métodos de SFM, en particular análisis de huesped asociado
basados en PCR dirigidos a marcadores genéticos de Bacteroides para investigar las
fuentes y los niveles de contaminación fecal en aguas recreativas y cuencas hidrográficas.
En un estudio realizado por Gourmelon et al. (2007), tres estuarios fueron comparados
por PCR utilizando marcadores específicos de Bacteroides humano en combinación con
diana especifica de humanos y animales. PCR resultó ser un indicador confiable de la
contaminación fecal. Bacteroides se observó en el 95% de las muestras fecales en todas
las plantas de tratamiento de aguas residuales y el estiércol de cerdo líquido. Otro estudio
dirigido a Bacteroides, Shanks et al. (2010), compararon siete análisis de PCR y qPCR
dirigidos a genes de Bacteroides que fueron relacionados con heces rumiantes o bovinas.
PCR demostró niveles de prevalencia que variaron de 54% a 85% de todos los extractos
de ADN de 247 muestras fecales bovinas individuales y especificidad (que preciso el
análisis de PCR detectó muestras fecales bovinas conocidos) varió de 76% a 100% para
los análisis estudiados. Un estudio previo por Griffith, Weisberg y McGee (2003),
utilizando muestras ciegas demostró que métodos de fuente específicos para Bacteroides,
SFM identificó fuentes fecales correctamente cuando las fuentes compuestas con tan
115
poco como 1% del total de la contaminación fecal en las muestras. Aunque existe una
gran cantidad de conocimiento en la literatura, todavía hay muchos estudios de SFM en
curso dirigidas al gen 16S ARNr de Bacteroides para mejorar la detección y
caracterización de cuencas.
Aunque SFM de Bacteroides ha sido útil para la caracterización de la contaminación,
todavía es una ciencia emergente e investigaciones se están realizando actualmente para
validar métodos publicados y comprender mejor la eficacia de las tecnologías
disponibles. Extensas pruebas de campo está en curso para determinar la eficacia de
análisis publicados y la distribución geográfica de presuntos marcadores específicos de
humanos (McLain et al. 2009). Varios estudios recientes han revelado las pruebas de
heces de los animales domésticos, ganado, aves y mamíferos silvestres, así como peces y
otras especies acuáticas para la amplificación cruzada con análisis humanos y los
marcadores moleculares que previamente se pensaba ser específico ha humano (McLain
et al. 2009). Por lo tanto, es fundamental que los métodos basados en SFM sean
evaluados cuenca por cuenca para finalmente comprender la utilidad de los métodos para
la caracterización de la contaminación exacta.
SFM Apoya Caracterización de Cuencas e identificación de fuentes en Arizona.
El Departamento de Calidad Ambiental de Arizona (ADEQ) fue establecido por la
Legislatura Estatal de Arizona en 1986. El objetivo de ADEQ es proteger y mejorar la
salud pública, el bienestar y el medio ambiente en Arizona. Hoy en día, ADEQ
administra una variedad de programas para crear conciencia de los problemas del agua
116
que actualmente enfrenta Arizona. Además, ADEQ utiliza programas para mejorar el
bienestar y la salud de los habitantes de Arizona a través de asegurar que los recursos de
agua cumplan con los estándares regulatorios. Este agencia regulatoria mantiene una lista
nombrada 303d de los lugares que no cumplen con los estándares regulatorios de agua
limpia en todo el estado de Arizona (ADEQ 2010). Sección 303d requiere cargas totales
máximas diarias (TMDL) se establezcan para las aguas afectadas por los estados,
territorios y tribus autorizadas con la supervisión de la EPA de E. U. (Simpson, Santo
Domingo y Reasoner 2002). Un TMDL se define como la cantidad máxima de un
contaminante en el cuerpo de agua que puede recibir y aún cumplir con los límites
regulados para ese contaminante. A partir de 2008, ADEQ listó 17 cuencas deterioradas
en todo el estado de Arizona en la lista 303d debido a la presencia de E. coli en niveles
más altos que las criterios establecidos (US EPA 2008). Se anticipa que el número de
cuencas deterioradas se incrementará en el año 2013. ADEQ trabaja diligentemente para
traer esas cuencas deterioradas a estándar.
Recientemente, un método utilizado por la sección de ADEQ encargada de la ejecución
TMDL ha involucrado un seguimiento intensivo de calidad del agua por voluntarios
capacitados, junto con el uso de métodos innovadores de SFM. Este enfoque tiene como
objetivo entender y describir las líneas de acción necesarias para restablecer aguas
afectadas y para proteger y mantener las aguas no afectadas en todo el Estado de Arizona.
Como parte de este enfoque, los grupos interesados en cuencas locales y la agencia
estatal han comenzado a colaborar con las instituciones de investigación, la Universidad
de Arizona y la Universidad del Norte de Arizona, para utilizar técnicas de SFM para
117
identificar las fuentes de bacterias fecales y la contaminación microbiana dentro de las
cuencas hidrográficas deterioradas. El objetivo de este enfoque es identificar y
caracterizar apropiadamente las fuentes de contaminantes que causan el deterioro. En las
cuencas donde las fuentes no se conocen ni se entienden, las técnicas de SFM pueden
ayudar a identificar y eliminar las fuentes potenciales de bacterias fecales.
Hasta la fecha, más de 181 muestras de agua de superficie han sido colectadas por
voluntarios entrenados por profesores, personal y estudiantes de la Universidad de
Arizona Extensión Cooperativa en tres cuencas actualmente calificadas como
deterioradas por bacteria de E. coli por ADEQ (Figuras 6, 7 and 8). Investigaciones en la
Universidad de Arizona está en marcha para evaluar los métodos MST actualmente
publicados que produzcan datos fiables a partir de estas cuencas para el desarrollo e
implementación del TMDL. Los métodos de SFM fueron elegidos específicamente
dentro de estas regiones seleccionadas en el estado debido a la(s) fuente(s) de lo previsto
de las bacterias no visiblemente evidentes en estas cuencas. Más específicamente, los
métodos fueron seleccionados para diferenciar entre las fuentes humanas y bovinas de
Bacteroides presente en muestras de agua recogidas por voluntarios. Cada una de las
diferentes cuencas hidrográficas incluidas en este estudio tienen una diferente
caracterización del uso del suelo (urbano o rural) y las entradas potenciales dentro de su
área. El uso de los métodos mencionados anteriormente para identificar las fuentes de
contaminación fecal facultará ADEQ para trabajar con las partes interesadas dentro de la
comunidad para supervisar y solucionar lugares que contribuyen a la contaminación con
la intención de remover aguas afectadas de la lista en Arizona.
118
Referencias
Arizona Department of Environmental Quality. 2010 Water Quality [Online]
http://www.azdeq.gov/environ/water/index.html.
Bower, P. A., Scopel, C. O., Jensen, E. T., Depas, M. M., and McLellan, S. L. 2005.
Detection of Genetic Markers of Fecal Indicator Bacteria in Lake Michigan and
Determination of Their Relationship to Escherichia coli Densities Using Standard
Microbiological Methods. Appl. Environ. Microbiol. 71: 8305-8313.
Buchan, A., Alber, M., and Hodson, R. E. 2001. Strain-specific differentiation of
environmental Escherichia coli isolates via denaturing gradient gel electrophoresis
(DGGE) analysis of the 16S-23S intergenetic spacer region. FEMS Microbiol.
Ecol. 35: 313-321.
Field, K. G., and Bernhard, A. E. 2000. Identification of Nonpoint Sources of Fecal
Pollution in Coastal Waters by Using Host-Specific 16S Ribosomal DNA Genetic
Markers from Fecal Anaerobes. Appl. Environ. Microbiol. 66: 1587-1594.
Field, K. G., Bernhard, A. E., and Brodeur, T. J. 2003. Molecular Approaches To
Microbiological Monitoring: Fecal Source Detection. Environ. Monitoring and
Assessment 81: 313-326.
Field, K. G., and Dick, L. K. 2004. Rapid Estimation of Numbers of Fecal Bacteroidetes
by use of a Quantitative PCR Assay for 16S rRNA Genes. Appl. Environ.
Microbiol. 70: 5695-5697.
Fong, T. T., Griffin, D. W., and Lipp, E. K. 2005. Molecular Assays for Targeting
Human and Bovine Enteric Viruses in Coastal Waters and their Application for
Library-Independent Source Tracking. Appl. Environ. Microbiol. 71: 2070-2078.
Gourmelon, M., Caprais, M. P., Segura, R., Le Mennec, C., Lozach, S., Piriou, J. Y., and
Rince, A. 2007. Evaluation of Two Library-Independent Microbial Source
Tracking Methods To Identify Sources of Fecal Contamination in French
Estuaries. Appl. Environ. Microbiol. 73: 4857-4866.
Griffith, J. F., Weisberg, S. B., and McGee, C. D. 2003. Evaluation of microbial source
tracking methods using mixed fecal sources in aqueous test samples. J. Wat.
Health 1: 141-151.
Jenkins, M. W., Sangam, T., Lorente, M., Gichaba, C. M., and Wuertz, S. 2009.
Identifying human and livestock sources of fecal contamination in Kenya with
host-specific Bacteroidales assay. Water Research 43: 4956-4966.
119
Layton, A., McKay, L., Williams, D., Garrett, V., Gentry, R., and Sayler, G. 2006.
Development of Bacteroides 16S rRNA Gene TaqMan-Based Real-Time PCR
Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water.
Appl. Environ. Microbiol. 72: 4214-4224.
McLain, J. E., Ryu, H., Kabiri-Badr, L., Rock, C. M., and Abbaszadegan, M. 2009. Lack
of specificity for PCR assays targeting human Bacteroides 16S rRNA gene: crossamplification with fish feces. FEMS Microbiology Letters 299: 38-43.
Okabe, S., Okayama N., Savichtcheva O., and Ito, T. 2007. Quantification of hostspecific Bacteroides–Prevotella 16SrRNA genetic markers for assessment of fecal
pollution in freshwater. Appl. Microbiol. Biotechnol. 74: 890-901.
Parveen, S., Hodge, N. C., Stall, R. E., Farrah, S. R., and Tamplin, M. L. 2001
Phenotypic and Genotypic Characterization of Human and Nonhuman
Escherichia coli. Water Res. 35: 379-386.
Santo Domingo, J. W., Bambic, D. G., Edge, T. A., and Wuertz, S. 2007. Quo Vadis
Source Tracking? Towards a Strategic Framework for Environmental Monitoring
of Fecal Pollution. Water Res. 41: 3539-3552.
Scott, T. M., Rose, J. B., Jenkins, T. M., Farrah, S. R., and Lukasik, J. 2002. Microbial
Source Tracking: Current Methodology and Future Directions. Appl. Environ.
Microbiol. 68: 5796-5803.
Shanks, O. C., White, K., Kelty, C. A., Hayes, S., Sivaganesan, M., Jenkins, M., Varma,
M., and Haugland, R. A. 2010. Performance Assessment PCR-Based Assays
Targeting Bacteroidales Genetic Markers of Bovine Fecal Pollution. Appl.
Environ. Microbiol. 76: 1359-1366.
Simpson, J. M., Santo Domingo, J. W., and Reasoner, D. J. 2002. Microbial Source
Tracking: State of the Science. Environ. Sci. Technol. 36: 5279-5288.
Smith, C. J., Rocha, E. R., and Paster, B. J. 2006. The Medically Important Bacteroides
spp. in Health and Disease. Prokaryotes 7: 381-427.
Soller, J. A, Schoen, M. E., Bartrand, T., Ravenscroft, J. E., and Ashbolt, N. J. 2010.
Estimated human health risks from exposure to recreational waters impacted by
human and non-human sources of faecal contamination. Water Research 30: 1-18.
Stoeckel, D. M., Mathes, M. V., Hyer, K. E., Hagedorn, C., Kator, H., Lukasik, J.,
O’Brien, T. L., Fenger, T. W., Samadpour, M., Strickler, K. M., and Wiggins, B.
A. 2004. Comparison of Seven Protocols To Identify Fecal Contamination
Sources Using Escherichia coli. Environ. Sci. Technol. 38: 6109-6117.
120
US Environmental Protection Agency. 2005. Microbial source tracking guide. Document
EPA/600/R-05/064. U. S. Environmental Protection Agency, Washington, DC.
US Environmental Protection Agency. 2008. Arizona 2008 Water Quality Assessment
Report [Online]
http://iaspub.epa.gov/waters10/attains_index.control?p_area=AZ#wqs
US Environmental Protection Agency. 2009. Water Quality Standards [Online]
http://www.epa.gov/waterscience/standards/wqslibrary/az/az_9_wqs.pdf
US Environmental Protection Agency, Region 10. 2011. Using Microbial Source
Tracking to Support TMDL Development and Implementation [Online]
http://www.epa.gov/region10/pdf/tmdl/mst_for_tmdls_guide_04_22_11.pdf
121
Tablas
Tabla 1. Tipos comunes de métodos de seguimiento de fuente microbiana (SFM).
Ref: US EPA 2011
Biblioteca-dependiente
Biblioteca-independiente
Cultivo-dependiente
Bioquímico
 Resistencia a
antibióticos
 Utilización de carbono
Molecular
 Rep-PCR
 PFGE
 Ribo tipo
Cultivo-independiente
Bioquímico o
Molecular
 Bacteriófago
 Cultivo
bacteriano
Molecular
 PCR de huésped bacteriano
especificó
 PCR de huésped viral especificó
 PCR cuantitativo de huésped
especificó
122
Tabla 2. Términos de uso general (ref. US EPA 2011)
Términos de uso general:
Métodos Bioquímicos (fenotípicas) se refieren a la capacidad de observar físicamente una
característica de las bacterias aisladas que podrían haber sido adquiridos de la exposición a
diferentes especies huésped o el medio ambiente. Ejemplos pueden ser la resistencia a ciertos
antibióticos o la utilización de carbono como fuente de nutrientes.
Métodos de cultivo que dependen en bacterias de las muestras de agua que se cultivan en un
laboratorio.
Unidades formadoras de colonias (UFC) se refiere a la unidad de medida o de la
concentración de bacterias cultivadas.
Métodos de cultivo independientes aíslan e identifican el ADN directamente a partir de una
muestra de agua sin primero tener que cultivar las bacterias de la muestra.
Fuente fecal se refiere a un huésped humano o animal donde un microbio origina en los
residuos fecales de ese huésped. Dependiendo de la especificidad de un método de SFM, una
fuente fecal podría referirse a un grupo general de huéspedes (por ejemplo, todos los seres
humanos, todos los animales, o un grupo de animales, tales como los rumiantes), o un huésped
específico animal (por ejemplo, ganado, venados, perros, etc.)
Métodos de biblioteca dependientes identifican las fuentes de material fecal de las muestras
de agua basado en datos de huellas dactilares fenotípicas o genotípicas de las cepas de
bacterias de las fuentes fecales conocidas.
Métodos de biblioteca independientes identifican las fuentes fecales sobre las características
conocidas de huéspedes específicos de las bacterias sin necesidad de una biblioteca.
Seguimiento de fuente microbiana (SFM) se refiere a un grupo de métodos destinados a
discriminar entre fuentes humanas y no humanas de la contaminación fecal. Algunos métodos
están diseñados para diferenciar entre contaminación fecal originarios de especies de animales
individuales.
Cepa microbiana es una variante genética o subtipo de un microorganismo (por ejemplo, las
especies bacterianas).
Métodos moleculares (genotípica) utilizan las variaciones en la composición genética o el
ADN de cada organismo individual o bacterias. Esto se conoce como "huellas de ADN".
123
Imágenes / Figuras
Figura 1. Transmisión de agentes patógenos a través del agua.
124
Bacterias
coliformes
totales
Bacterias
coliformes
fecales
E. coli
Patógeno
Figura 2. Relación entre los indicadores y patógenos
125
Figura 3. Visualización de una muestra de agua contaminada con material fecal. Células
azules fluorescentes indican la presencia de E. coli en el agua.
126
Figura 4. Estudiante de doctorado, Berenise Rivera, demuestra una técnica estéril,
mientras analiza muestras de agua para las bacterias fecales.
127
Figura 5. Extracción/Concentración de ADN.
128
Figura 6. Voluntarios del equipo de monitoreo de calidad del agua reciben entrenamiento
organizado por personal de Extensión Cooperativa de la UA.
129
Figura 7. Voluntario de monitoreo de calidad del agua en el Río Santa Cruz, Arizona.
130
Figura 8. Muestras de agua ambientales colectadas en el campo.
131
APPENDIX E
WATER QUALITY, E. COLI AND YOUR HEALTH
(Published in College of Agriculture and Life Sciences Cooperative Extension)
Berenise Rivera, MPH, PhD Student, Soil/Water and Environmental Science
Dr. Channah Rock, Extension Water Quality Specialist/Assistant Professor, Soil/Water
and Environmental Science
What is Water Quality?
Water quality refers to the chemical, physical or biological characteristics of water. Water
quality is a measure of the condition of water relative to its’ impact on one or more
aquatic species like fish and frogs or on human uses such as drinking and swimming. The
most common standards used to assess water quality relate to health of ecosystems, safety
of human contact and drinking water. Water quality protection programs in Arizona are
based on federal and state law and are administered by the U.S. Environmental Protection
Agency (EPA) or Arizona Department of Environmental Quality (ADEQ) to keep
ecosystems and people safe.
What is E. coli?
Escherichia coli (E. coli) are gram-negative bacteria and are a type of fecal coliform
bacteria commonly found in the intestines of animals and humans (Figure 1). E. coli are
so small they can’t be seen without a microscope; however, their growth can be seen as
132
colonies on agar media (like JELL-O) under special conditions (Ingerson and Reid,
2011). Most E. coli do not cause illness but if a person becomes sick from E. coli, the
primary site of infection is the gastrointestinal tract and symptoms can include nausea,
vomiting, diarrhea, and fever. This bacterium lives and grows naturally in the
gastrointestinal tract of humans and animals but if it gets in the wrong place in the body,
for example, the kidneys or blood, it can cause illness. According to Ingerson and Reid
(2011), the infection may spread within the body (to blood, liver, and nervous system).
These microorganisms are shed in fecal material, or feces, hence their spread is termed
the “fecal-oral” route of transmission. Contaminated food and water are the most
common ways to be exposed to E. coli. There are specific types (also called “strains”) of
E. coli that can cause disease and there are also harmless types. Some of the harmful
types of E. coli are classified into the following groups: Enterotoxigenic (ETEC),
Enteropathogenic (EPEC), Enterohemorragic (EHEC) and Enteroinvasive (EIEC). ETEC,
EPEC and EIEC are all generally transmitted through contaminated food and water
(Gerba et al., 2009 and Vieira et al., 2007). Table 1 summarizes the harmful types of E.
coli, mode of transmission, and disease outcome. A more well-known type or strain of E.
coli is O157:H7 which is found under the EHEC group and is commonly the cause of
contaminated foods such as spinach and meat but has also been implicated in outbreaks
where water was the source of contamination.
133
E. coli in Our Water
The presence of E. coli in water is a strong indication of recent sewage or animal waste
contamination. It is important to note that E. coli and waste can get in our water in many
different ways. For example, during rainfall and snow melt, E. coli may be washed into
creeks, rivers, streams, lakes, or groundwater (Griffith et al., 2003, Roslev and Bukh,
2011) from the land surface. Other ways consist of natural wildlife, failing septic
systems, recreational activities and local land use practices (for example, manure used as
fertilizers, livestock, concentrated feeding operations). Human and animal sources of
fecal pollution represent a serious health risks because of the high likelihood of the
existence of pathogens also in the fecal waste. A pathogen is a microorganism that can
cause disease and make someone sick. Cattle, swine, and chickens also carry pathogens
that can be transmitted from animals to humans causing disease. Therefore introduction
of any animal or human waste in water is of high concern.
Numerous studies have been conducted around the world to assess the connection
between water quality and serious health effects to people who come into contact with
that water through recreation (swimming, wading, fishing, etc.). Although not all E. coli
bacteria are typically pathogenic, extensive studies have demonstrated that E. coli
concentrations are the best predictor of swimming-associated gastrointestinal illness
(diarrhea). In addition to gastrointestinal illness (GI), illnesses such as eye infections,
skin irritations, ear, nose, throat infections, and respiratory illness are also common in
people who have come into contact with water contaminated with feces. Some studies
134
have pointed out that the rates of some serious health effects, such as those mentioned
above, are higher in swimmers when compared to non-swimmers (Soller et al., 2010).
The presence of E. coli may be indicative of contamination with other bacteria,
viruses or protozoa that can make you sick. Salmonella is a bacterium commonly
implicated in contaminated food and water. Salmonella can cause diseases such as
typhoid fever from consumption of contaminated water and Salmonellosis from eating
contaminated beef and poultry. A person consuming contaminated food or water can
experience nausea, vomiting, abdominal cramps, diarrhea, and fever. Another common
water-borne (spends all or part of its life in water) pathogen, Cryptosporidium, is a
protozoan parasite affecting the gastrointestinal tract of humans and animals and it is
shed in the feces in the form of an oocyst. This oocyst consists of a hard outer shell that
protects it from degradation in the environment. Cryptosporidium is highly resistant to
chlorine commonly used in drinking water treatment, and has been implicated in several
waterborne disease outbreaks in the past. One such outbreak took place in Milwaukee on
April 1993, which infected over 400,000 people and killed more than 100 (Gerba, 2009).
Heavy rains flooded agricultural plains in Wisconsin and produced substantial runoff into
a river that provided the City of Milwaukee with drinking water. The drinking water
treatment facility was not able to adequately treat or “kill” the high levels of
Cryptosporidium in the water due to their highly resistant outer shell. The Milwaukee
outbreak is an example of the dangers protozoa can pose in drinking water. To date, the
Milwaukee outbreak is the largest outbreak to be documented in the United States. As
demonstrated by the number of people infected in the Milwaukee outbreak, consequences
135
of consuming fecally contaminated water may be severe in people with weakened
immune systems (e.g., infants and the elderly) and sometimes fatal in people with
severely compromised immune systems.
Because contaminated water poses such a large threat to human health, water
managers and regulatory agencies have designed tests to tell us our water is safe. We
commonly use E. coli to indicate that fecal contamination is present in water. Although,
we do not want to find E. coli in our water, these bacteria can be easily tested and
quantified by simple methods. Detection of these bacteria in water means that fecal
contamination has occurred and suggests that enteric pathogens, like the ones mentioned
above, may be present. This also means that humans and animals should not come into
contact with the contaminated water until the presence of E. coli is no longer detected,
and the water is considered safe.
How do we make sure our water is safe?
Numerous government and state agencies as well as local watershed groups test water
quality to ensure it is safe or if there are potential problems with contamination. Water
quality testing and data reporting in the past were based on bacterial groups called total
and fecal coliforms. Coliforms can be found in the aquatic environment, in soil, and on
vegetation; they are universally present in large numbers in the feces of warm-blooded
animals. While coliforms themselves are not normally causes of serious illness, they are
easy to culture and their presence is used to indicate that other pathogenic organisms of
fecal origin may be present. Today, water quality testing has evolved and is now based on
136
the concentration of E. coli. E. coli is one of the types of bacteria within the fecal
coliform group and is a predictor of fecal contamination. Water that is consumed for
drinking water purposes is tested for the concentration, or level, of E. coli that is deemed
safe for human consumption. Similarly, wastewater that has been treated and then
recycled for irrigation purposes and/or discharged to surface waters must also meet
certain levels of E. coli to be considered safe. Rivers that are used for recreation, such as
fishing and swimming, are required to meet certain levels of E. coli or they can be
deemed “impaired” (Rivera and Rock, 2011). Table 2 outlines the various acceptable
levels/concentrations of E. coli of the different water uses mentioned above. The
concentrations of E. coli used in regulation are based on assessment of the volume of
water a person consumes during different practices and the likelihood the person would
become sick after coming into contact with the contaminated water. In circumstances
where the contact or ingestion of the water is high (swimming) the concentration of the E.
coli that is deemed acceptable is lower. In situations where the contact with the water is
low (irrigation) the levels of E. coli considered acceptable may be higher because there is
a lower risk of a person becoming sick.
E. coli is currently the most reliable indicator of fecal bacterial contamination of
surface waters in the U.S. according to water quality standards set by the EPA. EPA
bacterial water quality standards are based on a level of E. coli in water above which the
health risk from waterborne illness is unacceptably high. Due to the many associated
health risks the presence of pathogens and other microorganisms can pose, regulators
such as the US EPA and ADEQ have implemented ways to reduce contact with impaired
137
waters by defining various water use categories. Two of these categories are partial-body
contact (PBC) and full-body contact (FBC). According to the US EPA, partial-body
contact refers to the human body coming in contact with surface water used for
recreational activities, but not to the point of full-body submergence (2009). Levels of E.
coli cannot exceed 575 colony forming units (CFU) per 100 mL of water for partial body
contact (US EPA, 2009). The term CFU refers to the number of living bacterial cells in a
water sample. Therefore, this measure is used to tell us the degree of contamination in
samples of water or the degree of the infection in humans and animals. For full-body
contact, E. coli levels cannot exceed 235 CFU per 100 mL of water. Full-body contact
refers to the human body being completely underwater in activities such as swimming or
other recreational activity (US EPA, 2009).
What can you do in your community to protect water quality?
Essential to human beings and ecosystems, water is closely linked with human life.
Numerous activities that occur within your community can ultimately impact surface
water quality. Here are some ways you can help keep rivers, lakes and streams safe for
both people and ecosystems:

Learn about your local water body or watershed

Identify ways you can help prevent polluted runoff from your home, ranch, or
farm

Pick up pet waste in and around your neighborhood

Keep domestic animals and/or livestock out of waterways (or reduce their
exposure)

Properly maintain your septic system and have it inspected when appropriate
138

Join a local watershed group or volunteer organization active in environmental
issues in your community

Volunteer during clean up events targeting pollution near surface waters

Do not throw trash into rivers, lakes, and streams (while the trash may not contain
fecal matter or waste, it may attract wild or domestic animals which may
introduce fecal contamination near water bodies and causing pollution)

When camping or hiking, properly dispose of waste and trash to reduce the
attraction to animals
Water is a very precious resource; by doing your part to protect our water sources we can
ensure benefits to future generations and to the safety of its users.
139
References
Arizona Department of Environmental Quality. 2010 Water Quality. [Online]
http://www.azdeq.gov/environ/water/index.html.
Francy, D. S., Myers, D. N., and Metzker K. D. 1993 Escherichia coli and fecal coliform
bacteria as indicators of recreational water quality. U.S. Geological Survey. Water
Resources Investigations Report 93-4083. Columbus, Ohio.
Gerba, C. “Indicator Microorganisms.” Environmental Microbiology. 2nd Ed. Academic
Press, San Diego, CA, 2009. 485-499.
Gerba, C. “Environmentally Transmitted Pathogens.” Environmental Microbiology. 2nd
Ed. Academic Press, San Diego, CA, 2009. 445-484.
Griffith, J. F., Weisberg, S. B., and McGee C. D. 2003 Evaluation of microbial source
tracking methods using mixed fecal sources in aqueous test samples. J. Wat.
Health 1: 141-151.
Hathaway, J. M. and Hunt, W. F. 2008 URBAN Waterways: Removal of Pathogens in
Stormwater. North Carolina Cooperative Extension Service, AGW-588-16W.
Ingerson, M. M. and Reid, A. 2011 E. coli: Good, Bad, & Deadly. American Academy of
Microbiology. pg. 1-14.
Rivera, B. and Rock, C. 2011 Microbial Source Tracking: Watershed Characterization
and Source Identification. Arizona Cooperative Extension, az1547.
Roslev, P., and Bukh, A. S. 2011 State of the Art Molecular Markers for Fecal Pollution
Source Tracking in Water. Appl Microbiol Biotechnol 89: 1341-1355.
Soller, J.A, Schoen, M. E., Bartrand, T., Ravenscroft, J.E., and Ashbolt, N. J. 2010
Estimated human health risks from exposure to recreational waters impacted by
human and non-human sources of faecal contamination. Water Research 30: 1-18.
Vieira, N., Bates, S. J., Solberg, O. W., Ponce, K., Howsmon, R., Cevallos, W., Trueba,
G., Riley, L. and Eisenberg, J. N. S. 2007 High Prevalence of Enteroinvasive
Escherichia Coli Isolated in a Remote Region of Northern Coastal Ecuador. Am J
Trop Med Hyg 7: 528-533.
U. S. Environmental Protection Agency. 2008 Arizona 2008 Water Quality Assessment
Report. [Online]
http://iaspub.epa.gov/waters10/attains_index.control?p_area=AZ#wqs.
140
U.S. Environmental Protection Agency. 2009 Water Quality Standards [Online]
http://www.epa.gov/waterscience/standards/wqslibrary/az/az9wqs.pdf
U. S. Senate. 2002 Federal Water Pollution Control Act. [Online]
http://www.epw.senate.gov/water.pdf.
141
Figures and Tables
Figure 1. E. coli - Gram-negative, facultatively anaerobic, rod prokaryote; with multiple
flagella and fimbriae. E. coli can cause urinary tract infections, traveler's diarrhea and
nosocomial infections. (Dennis Kunkel Microscopy, Inc./Visuals Unlimited, Inc.)
142
Table 1. Harmful strains of E. coli
Strains of E. coli
Modes of Transmission
Disease
ETEC causes diarrhea without
fever. It is common in infants
and is often the cause of
travelers’ diarrhea
EPEC causes watery,
sometimes bloody diarrhea. It
Enteropathogenic Food or water ingestion, direct and
is a common cause of
indirect human contact
(EPEC)
infantile diarrhea in
underdeveloped countries.
EHEC strains cause bloody
diarrhea and can sometimes
damage the kidneys and
progress to the potentially
Enterohemorragic Food/ingestion, direct or indirect fatal hemolytic uremic
human contact
syndrome (HUS). EHEC has
(EHEC)
caused many large food-borne
outbreaks worldwide;
O157:H7 is the best known
strain.
EIEC causes watery,
Food and water ingestion
Enteroinvasive
dysentery like diarrhea. Fever
(EIEC)
is another common symptom.
Enterotoxigenic
(ETEC)
Food or water ingestion
143
Table 2. Level of E. coli permitted for Different Types of Water (ADEQ, 2010 and EPA,
2009)
Purpose
Drinking Water
Surface Water Full-Body Contact
(swimming)
Surface Water Partial-Body Contact
(Fishing, boating, etc…)
Wastewater
(irrigation or discharge)
Level of E. coli
Zero
235 cfu/100 mL
575 cfu/100 mL
< 2.2cfu/100 mL
< 1.0 cfu/100 mL
144
APPENDIX F
LA CALIDAD DEL AGUA, E. COLI Y SU SALUD
(Published in College of Agriculture and Life Sciences Cooperative Extension)
Berenise Rivera, MPH, Candidata a Doctorado, Suelo / Agua y Ciencias Ambientales
Dra. Channah Rock, Especialista en Calidad del Agua de extensión/ Profesor, Suelo /
Agua y Ciencias Ambientales
¿Qué es La Calidad del Agua?
La calidad del agua se refiere a las características químicas, físicas o biológicas del agua.
La calidad del agua es una medida de la condición del agua en relación con su impacto en
una o más especies acuáticas como peces y ranas o en usos humanos, ya sea para
consumo o recreativo. Los estándares más comunes que se utilizan para evaluar la calidad
del agua se relacionan con la salud de los ecosistemas, la seguridad del contacto humano
y el agua potable. Los programas de protección de la calidad del agua en Arizona se
basan en la ley federal y estatal, y son administrados por la Agencia de Protección
Ambiental (EPA) de E. U. o el Departamento de Calidad Ambiental de Arizona (ADEQ)
para mantener los ecosistemas y la seguridad del público.
Qué es E. coli?
Escherichia coli (E. coli) son bacterias gram-negativo y son un tipo de bacterias
coliformes fecales que se encuentran comúnmente en los intestinos de los animales y los
seres humanos (Figura 1). E. coli son tan pequeños que no se pueden ver sin un
145
microscopio, sin embargo, su crecimiento puede verse como colonias en medios de agar
(como gelatina) en condiciones especiales (Ingerson y Reid, 2011). La mayoría de las
bacterias E. coli no causan enfermedad, pero si una persona se enferma de E. coli, el sitio
primario de infección es el tracto gastrointestinal y los síntomas pueden incluir náusea,
vómito, diarrea y fiebre. Esta bacteria vive y crece de forma natural en el tracto
gastrointestinal de los seres humanos y los animales, pero si entra en el lugar equivocado
en el cuerpo, por ejemplo, los riñones o la sangre, puede causar enfermedad. Según
Ingerson y Reid (2011), la infección puede diseminarse en el cuerpo (a la sangre, el
hígado y el sistema nervioso). Estos microorganismos se eliminan en el material fecal, o
las heces, y la ruta de transmisión es "fecal-oral". Los alimentos y agua contaminada son
las formas más comunes de ser expuestos a E. coli. Hay tipos específicos (también
llamadas "cepas") de E. coli que pueden causar enfermedades y también hay tipos que no
causan ninguna enfermedad. Algunos de los tipos dañinos de E. coli se clasifican en los
siguientes grupos: Enterotoxigénico (ETEC), Enteropatógenos (EPEC),
Enterohemorrágico (EHEC) y Enteroinvasivo (EIEC). ETEC, EPEC y EIEC son
transmitidos generalmente a través de alimentos y agua contaminada (Gerba et al, 2009 y
Vieira et al, 2007). La Tabla 1 resume los tipos dañinos de E. coli, el modo de
transmisión y evolución de la enfermedad. Un tipo mejor conocido de E. coli es O157:
H7 que se encuentra bajo el grupo EHEC y es comúnmente la causa de alimentos
contaminados tales como espinacas y carne, pero también se ha implicado en epidemias
donde el agua era la fuente de la contaminación.
146
E. coli en el Agua
La presencia de E. coli en el agua es una fuerte indicación de una reciente contaminación
de aguas residuales o contaminación de residuos de animales. Es importante tener en
cuenta que E. coli y los residuos de animales/humanos pueden entrar en nuestra agua de
muchas maneras diferentes. Por ejemplo, durante la lluvia y derretimiento de la nieve, E.
coli se puede lavar en los ríos, arroyos, lagos o aguas subterráneas (Griffith et al 2003,
Roslev y Bukh, 2011) de la superficie de la tierra. Otras formas son la fauna silvestre,
fosas sépticas defectuosas, actividades recreativas y prácticas locales de uso del suelo
(por ejemplo, estiércol utilizado como fertilizante y ganado). Las fuentes de
contaminación fecales de humanos y animales representan un grave riesgo para la salud
debido a la alta probabilidad de la existencia de agentes patógenos en los residuos
fecales. Un patógeno es un microorganismo que puede causar enfermedades y causar
enfermedades en las personas. El ganado vacuno, cerdos y gallinas también acarrean
patógenos que pueden causar enfermedades y pueden transmitirse de animales a
humanos. Por lo tanto, la introducción de heces de animales o humanos en el agua es de
mucha preocupación.
Numerosos estudios se han realizado en todo el mundo para evaluar la relación
entre la calidad del agua utilizada para actividades recreacionales; y los efectos adversos
en la salud de las personas que tienen contacto con el agua a través de actividades
recreativas (natación, pesca, etc.). Aunque no todas las bacterias E. coli son patogénicas,
los estudios llevados a cabo han demostrado que las concentraciones de E. coli son el
mejor indicador de enfermedades gastrointestinales (diarrea) asociadas a la natación.
147
Además de las enfermedades gastrointestinales (GI), infecciones de los ojos, irritaciones
de la piel, oído, nariz, infecciones de garganta, y enfermedades de las vías respiratorias,
son comunes en las personas que han estado en contacto con agua contaminada con heces
fecales. Algunos estudios han señalado que las tasas de algunos efectos adversos a la
salud, tales como los mencionados anteriormente, son más altos en los nadadores, en
comparación con los no nadadores (Soller et al., 2010).
La presencia de E. coli puede ser indicativo de la contaminación con otras
bacterias, virus o protozoos que pueden causar enfermedades. Salmonella es una bacteria
comúnmente implicada en alimentos y agua contaminados. Salmonella puede causar
enfermedades como la fiebre tifoidea por el consumo de agua contaminada y
Salmonelosis por comer carne de res y pollo contaminado. Una persona que consume
alimentos o agua contaminada puede experimentar náuseas, vómitos, cólicos
abdominales, diarrea y fiebre. Otro patógeno común transmitido por el agua (pasa toda o
la mayor parte de su vida en el agua), Cryptosporidium, un parásito protozoario que
afecta el tracto gastrointestinal de humanos y animales, y se elimina en las heces en
forma de ooquistes. Estos ooquistes consisten de una cáscara exterior dura que lo protege
de la degradación en el medio ambiente. Cryptosporidium es muy resistente al cloro
comúnmente utilizado para el tratamiento de agua potable, y se ha implicado en varias
epidemias de enfermedades transmitidas por el agua en el pasado. Uno de estas epidemias
tuvo lugar en Milwaukee en Abril de 1993, que infectó a más de 400,000 personas y mató
a más de 100 (Gerba, 2009). Las fuertes lluvias inundaron llanos agrícolas en Wisconsin
y produjeron escurrimiento al río que proporciona agua potable a la ciudad de
148
Milwaukee. La planta de tratamiento de agua potable no fue capaz de tratar
adecuadamente para controlar los altos niveles de Cryptosporidium en el agua debido a
su resistente capa exterior. La epidemia de Milwaukee es un ejemplo de los peligros que
pueden representar los protozoarios en el agua potable. Hasta la fecha, la epidemia de
Milwaukee es la epidemia más grande que ha sido documentada en los Estados Unidos.
Como lo demostró el número de personas infectadas en la epidemia de Milwaukee, las
consecuencias del consumo de agua contaminada con material fecal pueden ser graves en
personas con sistemas inmunológicos debilitados (por ejemplo, niños y ancianos) y
algunas veces fatal en personas con sistemas inmunológicos gravemente comprometidos.
Ya que el agua contaminada posa una gran amenaza para la salud humana, los
administradores del agua y las agencias reguladoras han diseñado pruebas para informar
al público si nuestra agua es segura. Comúnmente utilizamos E. coli para indicar que la
contaminación fecal se encuentra presente en el agua. A pesar de que no queremos
encontrar E. coli en el agua, estas bacterias pueden ser fácilmente probados y
cuantificados por métodos simples. La detección de estas bacterias en el agua significa
que contaminación fecal ha ocurrido y sugiere que los patógenos entéricos, como los
mencionados anteriormente, pueden estar presentes. Esto también significa que los
humanos y los animales no deben entrar en contacto con el agua contaminada hasta que
la presencia de E. coli ya no sea detectada, y el agua se considera segura.
149
La presencia de E. coli puede ser indicativo de la contaminación con otras
bacterias, virus o protozoos que pueden causar enfermedades. Salmonella es una bacteria
comúnmente implicada en alimentos y agua contaminados. Salmonella puede causar
enfermedades como la fiebre tifoidea por el consumo de agua contaminada y
Salmonelosis por comer carne de res y pollo contaminado. Una persona que consume
alimentos o agua contaminada puede experimentar náuseas, vómitos, cólicos
abdominales, diarrea y fiebre. Otro patógeno común transmitido por el agua (pasa toda o
la mayor parte de su vida en el agua), Cryptosporidium, un parásito protozoario que
afecta el tracto gastrointestinal de humanos y animales, y se elimina en las heces en
forma de ooquistes. Estos ooquistes consisten de una cáscara exterior dura que lo protege
de la degradación en el medio ambiente. Cryptosporidium es muy resistente al cloro
comúnmente utilizado para el tratamiento de agua potable, y se ha implicado en varias
epidemias de enfermedades transmitidas por el agua en el pasado. Uno de estas epidemias
tuvo lugar en Milwaukee en Abril de 1993, que infectó a más de 400,000 personas y mató
a más de 100 (Gerba, 2009). Las fuertes lluvias inundaron llanos agrícolas en Wisconsin
y produjeron escurrimiento al río que proporciona agua potable a la ciudad de
Milwaukee. La planta de tratamiento de agua potable no fue capaz de tratar
adecuadamente para controlar los altos niveles de Cryptosporidium en el agua debido a
su resistente capa exterior. La epidemia de Milwaukee es un ejemplo de los peligros que
pueden representar los protozoarios en el agua potable. Hasta la fecha, la epidemia de
Milwaukee es la epidemia más grande que se sido documentada en los Estados Unidos.
Como lo demostró el número de personas infectadas en la epidemia de Milwaukee, las
150
consecuencias del consumo de agua contaminada con material fecal pueden ser graves en
personas con sistemas inmunológicos debilitados (por ejemplo, niños y ancianos) y
algunas veces fatal en personas con sistemas inmunológicos gravemente comprometidos.
Ya que el agua contaminada posa una gran amenaza para la salud humana, los
administradores del agua y las agencias reguladoras han diseñado pruebas para informar
al público si nuestra agua es segura. Comúnmente utilizamos E. coli para indicar que la
contaminación fecal se encuentra presente en el agua. A pesar de que no queremos
encontrar E. coli en el agua, estas bacterias pueden ser fácilmente probados y
cuantificados por métodos simples. La detección de estas bacterias en el agua significa
que contaminación fecal ha ocurrido y sugiere que los patógenos entéricos, como los
mencionados anteriormente, pueden estar presentes. Esto también significa que los
humanos y los animales no deben entrar en contacto con el agua contaminada hasta que
la presencia de E. coli ya no sea detectada, y el agua se considera segura.
¿Cómo nos aseguramos de que nuestra agua es segura?
Numerosas agencias gubernamentales y estatales, así como grupos locales de cuencas
hacen pruebas de la calidad del agua para confirmar que el agua es segura o si existen
posibles problemas de contaminación. En el pasado, las pruebas de calidad del agua y la
presentación de datos se basaban en grupos de bacterias llamados coliformes totales y
fecales. Las bacterias coliformes se encuentran en el medio ambiente acuático, en el
suelo, y en la vegetación. Están universalmente presentes en grandes cantidades en las
151
heces de los animales de sangre caliente. Mientras que los coliformes normalmente no
causan enfermedades graves, son fáciles de cultivar y su presencia se utiliza para indicar
que otros organismos patógenos de origen fecal pueden estar presentes. Hoy en día, las
pruebas de calidad del agua han avanzado significantemente y ahora están basadas en la
concentración de E. coli. E. coli es uno de los tipos de bacterias dentro del grupo de
coliformes fecales y es un predictor de la contaminación fecal. El agua consumida como
agua potable se analiza para determinar la concentración, o el nivel, de E. coli que se
considera seguro para el consumo humano. Del mismo modo, las aguas residuales que
han sido tratadas y luego recicladas para fines de riego y-/-o descargadas en aguas
superficiales también debe cumplir con ciertos niveles de E. coli que se consideran
seguros. Los ríos que se utilizan para la recreación, como la pesca y la natación, están
obligados a cumplir con ciertos niveles de E. coli o pueden ser considerados
"deteriorados" (Rivera y Rock, 2011). La Tabla 2 resume los distintos niveles aceptables
/ concentraciones de E. coli de los diferentes usos del agua mencionado anteriormente.
Las concentraciones de E. coli utilizadas en el reglamento se basan en la evaluación del
volumen de agua que consume una persona durante las diferentes prácticas y la
probabilidad de que la persona pudiera enfermarse después de entrar en contacto con el
agua contaminada. En circunstancias en las que el contacto o la ingestión del agua es alta
(natación), la concentración de E. coli que se considera aceptable es menor. En
situaciones donde el contacto con el agua es baja (irrigación), los niveles de E. coli que se
consideren aceptables pueden ser más altos porque hay menos riesgo de que una persona
se enferme.
152
E. coli es actualmente el indicador más confiable de la contaminación bacteriana
fecal de las aguas superficiales en los E. U. de acuerdo con los estándares de calidad del
agua establecidos por el EPA. Los estándares bacterianos de calidad del agua del EPA se
basan en un nivel de E. coli en el agua por encima del cual el riesgo para la salud y
enfermedades transmitidas por el agua es inaceptablemente alta. Debido a los muchos
riesgos de salud asociados con la presencia de patógenos y otros microorganismos
pueden representar, las agencias reguladoras, como la EPA y ADEQ de E. U. han
implementado formas de reducir el contacto con aguas deteriorados mediante la
definición de las diferentes categorías de uso del agua. Dos de estas categorías son el
contacto corporal parcial (CCP) y el contacto corporal completo (CCC). De acuerdo con
el EPA de los E. U., el contacto corporal parcial (CCP) significa el uso recreativo de las
aguas superficiales que pueden causar que el cuerpo humano entre en contacto directo
con el agua, pero por lo general no hasta el punto de inmersión completa (2009). Los
niveles de E. coli no puede exceder de 575 unidades formadoras de colonias (UFC) por
cada 100 ml de agua para el contacto corporal parcial (CCP) (US EPA, 2009). El término
UFC se refiere al número de células bacterianas que viven en una muestra de agua. Por lo
tanto, esta medida se utiliza para decirnos el nivel de contaminación en muestras de agua
o el riesgo de infección en los seres humanos y los animales. Para el contacto corporal
completo, los niveles de E. coli no puede exceder 235 UFC por 100 ml de agua. Contacto
corporal completo se refiere al cuerpo humano completamente bajo el agua en
actividades como la natación o cualquier otra actividad recreativa acuática (US EPA,
2009).
153
¿Qué puede hacer en su comunidad para proteger la calidad del agua?
El agua es esencial para los seres humanos y los ecosistemas. Numerosas actividades que
ocurren dentro de su comunidad, en última instancia pueden afectar la calidad del agua
superficial. Aquí hay algunas maneras que usted puede ayudar a mantener los ríos, lagos
y arroyos seguros para las personas y los ecosistemas:

Aprenda acerca del agua local o cuencas

Identifique las formas en que puede ayudar a prevenir la escorrentías
contaminadas desde su casa, rancho o granja

Recoja los desechos de mascotas en y alrededor de su vecindario

Mantenga a los animales domésticos y / o ganado alejado de los cuerpos de agua
(o reducir su exposición)

Mantenga correctamente su sistema séptico e inspecciónelo cuando sea apropiado

Únase a un grupo de cuenca local u organización voluntaria activa en temas
ambientales en su comunidad

Ser voluntario durante las campañas de limpieza dirigidas a la contaminación
cerca de las aguas superficiales

No tire basura en los ríos, lagos y arroyos (aunque la basura no contenga material
fecal o residuos, pero puede atraer a animales silvestres o domésticos que pueden
introducir contaminación fecal a cuerpos de agua cercanos y causar
contaminación)

Al acampar o ir de excursión, disponga adecuadamente de los desechos y la
basura para reducir la atracción de animales
El agua es un recurso muy valioso, haciendo su parte para proteger nuestras fuentes de
agua, podemos asegurar los beneficios para las generaciones futuras y para la seguridad
de sus usuarios.
154
Referencias
Arizona Department of Environmental Quality. 2010 Water Quality. [Online]
http://www.azdeq.gov/environ/water/index.html.
Francy, D. S., Myers, D. N., and Metzker K. D. 1993 Escherichia coli and fecal coliform
bacteria as indicators of recreational water quality. U.S. Geological Survey. Water
Resources Investigations Report 93-4083. Columbus, Ohio.
Gerba, C. “Indicator Microorganisms.” Environmental Microbiology. 2nd Ed. Academic
Press, San Diego, CA, 2009. 485-499.
Gerba, C. “Environmentally Transmitted Pathogens.” Environmental Microbiology. 2nd
Ed. Academic Press, San Diego, CA, 2009. 445-484.
Griffith, J. F., Weisberg, S. B., and McGee C. D. 2003 Evaluation of microbial source
tracking methods using mixed fecal sources in aqueous test samples. J. Wat.
Health 1: 141-151.
Hathaway, J. M. and Hunt, W. F. 2008 URBAN Waterways: Removal of Pathogens in
Stormwater. North Carolina Cooperative Extension Service, AGW-588-16W.
Ingerson, M. M. and Reid, A. 2011 E. coli: Good, Bad, & Deadly. American Academy of
Microbiology. pg. 1-14.
Rivera, B. and Rock, C. 2011 Microbial Source Tracking: Watershed Characterization
and Source Identification. Arizona Cooperative Extension, az1547.
Roslev, P., and Bukh, A. S. 2011 State of the Art Molecular Markers for Fecal Pollution
Source Tracking in Water. Appl Microbiol Biotechnol 89: 1341-1355.
Soller, J.A, Schoen, M. E., Bartrand, T., Ravenscroft, J.E., and Ashbolt, N. J. 2010
Estimated human health risks from exposure to recreational waters impacted by
human and non-human sources of faecal contamination. Water Research 30: 1-18.
Vieira, N., Bates, S. J., Solberg, O. W., Ponce, K., Howsmon, R., Cevallos, W., Trueba,
G., Riley, L. and Eisenberg, J. N. S. 2007 High Prevalence of Enteroinvasive
Escherichia Coli Isolated in a Remote Region of Northern Coastal Ecuador. Am J
Trop Med Hyg 76: 528-533.
U. S. Environmental Protection Agency. 2008 Arizona 2008 Water Quality Assessment
Report. [Online]
http://iaspub.epa.gov/waters10/attains_index.control?p_area=AZ#wqs.
155
U.S. Environmental Protection Agency. 2009 Water Quality Standards [Online]
http://www.epa.gov/waterscience/standards/wqslibrary/az/az_9_wqs.pdf
U. S. Senate. 2002 Federal Water Pollution Control Act. [Online]
http://www.epw.senate.gov/water.pdf.
156
Figuras y Tablas
Figura 1. E. coli – Gram-negativos, anaerobios facultativos, procariotas vara; con
múltiples flagelos y fimbrias. E. coli puede causar infecciones del tracto urinario, diarrea
de viajero y las infecciones nosocomiales. (Dennis Kunkel Microscopy, Inc./Visuals
Unlimited, Inc.)
157
Tabla 1. Cepas dañinas de E. coli
Cepas de E. coli
Modo de Transmisión
Enfermedad
ETEC provoca diarrea sin
fiebre. Es común en los bebés
y es a menudo la causa de
diarrea de los viajeros.
EPEC causa diarrea acuosa, a
La ingestión de alimentos o agua, veces con sangre. Es una
Enteropatógeno
el contacto humano directo e
causa común de diarrea
(EPEC)
indirecto
infantil en los países
subdesarrollados.
Cepas de EHEC causan
diarrea con sangre y, a veces
pueden dañar los riñones y el
progreso al síndrome urémico
Enterohemorrágico Alimentos / ingestión, el contacto hemolítico potencialmente
humano directo o indirecto
fatal (SUH). EHEC ha
(EHEC)
causado muchas epidemias de
origen alimentario en todo el
mundo; O157: H7 es la cepa
más conocida.
EIEC causa disentería, como
La ingestión de alimentos o agua
Enteroinvasivo
la diarrea. La fiebre es un
(EIEC)
síntoma común.
Enterotoxigénic
(ETEC)
Alimentos o ingestión de agua
158
Tabla 2. Niveles de E. coli permitidos para los diferentes tipos de agua (ADEQ, 2010 and
EPA, 2009)
Propósito
Agua Potable
Aguas Superficiales con Contacto
Corporal Completo
(natación)
Aguas Superficiales con Contacto
Corporal Parcial
(pesca, paseo en embarcaciones, etc…)
Aguas Residuales
(riego o descarga)
Nivel de E. coli
Cero
235 ufc/100 mL
575 ufc/100 mL
< 2.2 ufc/100 mL
< 1.0 ufc/100 mL
159
APPENDIX G
RAW DATA FOR APPENDIX A
Table 1. Raw Data from the San Francisco River.
Sampling Sites
Upper San Francisco
Upper San Francisco
Upper San Francisco
Upper San Francisco
Upper San Francisco
Upper San Francisco
Upper San Francisco
Upper San Francisco
Upper Blue
Upper Blue
Upper Blue
Upper Blue
Upper Blue
Upper Blue
Upper Blue
Lower Blue
Lower Blue
Lower Blue
Lower Blue
Lower Blue
Date Collected
10/25/2010
10/25/2010
12/15/2010
12/15/2010
12/15/2010
12/15/2010
12/15/2010
12/15/2010
10/28/2010
10/28/2010
10/28/2010
11/27/2010
11/27/2010
7/16/2011
7/16/2011
7/3/2010
10/26/2010
10/26/2010
10/26/2010
10/26/2010
E.coli
4.16E+01
4.57E+01
1.51E+01
1.81E+01
3.07E+01
1.03E+01
1.92E+01
1.76E+01
ND
1.34E+01
1.21E+01
4.32E+01
4.32E+01
3.08E+02
5.79E+02
2.61E+02
5.93E+01
4.59E+01
5.82E+01
6.28E+01
Human (100ml)
7.64E+02
4.54E+02
4.84E-01
2.96E-01
1.51E-01
4.28E+09
8.03E+00
0.00E+00
0.00E+00
2.45E+00
0.00E+00
3.13E+01
1.39E+01
1.75E+01
5.55E+02
9.60E+00
2.45E+02
6.27E+00
1.16E+02
4.50E+02
Total (100ml)
2.24E+04
2.82E+04
1.88E+04
9.00E+04
6.39E+04
7.41E+04
2.92E+04
4.55E+04
1.62E+03
6.51E+03
1.14E+03
6.34E+03
4.10E+03
1.25E+05
4.33E+05
2.67E+02
2.07E+04
1.65E+04
2.00E+04
1.29E+04
Bovine (100ml)
0.00E+00
2.08E+03
2.31E+02
8.59E+01
0.00E+00
2.66E+01
0.00E+00
7.34E+01
8.56E+01
2.52E+02
0.00E+00
3.18E+02
1.75E+02
0.00E+00
4.33E+14
0.00E+00
0.00E+00
0.00E+00
0.00E+00
3.68E+02
160
Lower Blue
Lower Blue
Lower Blue
Lower Blue
Lower Blue
Lower Blue
State Lands/BLM
11/4/2010
11/4/2010
11/16/2010
11/16/2010
8/15/2011
8/15/2011
7/24/2010
ND
ND
6.40E+01
7.70E+01
2.42E+03
2.42E+03
7.27E+02
4.73E+00
5.53E+00
2.85E+02
4.85E-01
1.06E+03
1.07E+03
2.55E+02
9.71E+02
1.18E+02
3.42E+03
1.78E+03
3.58E+06
2.80E+06
7.61E+03
4.21E+02
1.58E+02
2.28E+02
5.85E+02
3.85E+04
2.78E+04
1.47E+05
State Lands Main
Cross
7/21/2010
1.41E+03
3.25E+02
3.68E+03
0.00E+00
State Lands Main
Cross
10/17/2010
1.45E+01
0.00E+00
0.00E+00
1.07E+13
State Lands Main
Cross
10/17/2010
1.45E+01
0.00E+00
0.00E+00
0.00E+00
State Lands Main
Cross
10/17/2010
1.97E+01
0.00E+00
0.00E+00
6.31E+02
State Lands Main
Cross
10/17/2010
1.97E+01
0.00E+00
0.00E+00
3.39E+01
State Lands Main
Cross
7/6/2011
ND
0.00E+00
1.09E+06
7.32E+02
State Lands Main
Cross
7/6/2011
ND
0.00E+00
1.12E+06
1.76E+03
State Lands Main
Cross
9/11/2011
6.49E+02
7.60E+00
4.05E+05
1.96E+03
State Lands Main
Cross
9/11/2011
6.87E+02
1.05E+02
2.26E+03
6.85E+02
State Lands Main
Cross
11/19/2011
4.61E+01
0.00E+00
3.43E+05
0.00E+00
161
State Lands Main
Cross
11/19/2011
3.76E+01
0.00E+00
2.57E+05
0.00E+00
State Lands Main
Cross
8/1/2011
1.99E+03
7.59E+00
2.52E+02
0.00E+00
State Lands Main
Cross
8/1/2011
1.73E+03
0.00E+00
1.33E+04
0.00E+00
State LandsHole in the
Rock
7/12/2010
1.30E+03
6.30E+02
1.15E+04
0.00E+00
7/21/2010
9.21E+02
7.83E+02
6.15E+03
0.00E+00
11/1/2010
2.63E+01
1.03E+05
4.63E-04
0.00E+00
11/1/2010
1.45E+01
0.00E+00
0.00E+00
0.00E+00
8/1/2011
2.42E+03
6.80E+02
3.80E+05
1.08E+03
8/1/2011
2.42E+03
5.92E+02
1.33E+06
4.01E+02
11/19/2011
4.74E+01
4.58E+00
7.48E+05
1.43E+03
11/19/2011
4.16E+01
1.11E+00
1.10E+06
2.31E+02
11/1/2010
2.69E+01
6.70E+04
0.00E+00
1.31E+02
11/1/2010
3.35E+01
0.00E+00
3.31E+02
9.29E+01
7/24/2010
11/9/2010
11/9/2010
7.70E+02
2.18E+01
3.75E+01
6.63E+02
0.00E+00
0.00E+00
1.44E+04
0.00E+00
3.89E-08
0.00E+00
0.00E+00
1.06E+11
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
State LandsHole in the
Rock
Kaler Deeded Land
Kaler Deeded Land
Kaler Deeded Land
162
Kaler Deeded Land
Kaler Deeded Land
Kaler Deeded Land
11/9/2010
11/9/2010
7/5/2011
3.22E+01
2.69E+01
2.42E+03
0.00E+00
5.00E+01
1.22E+02
6.52E-06
7.65E-06
7.88E+08
0.00E+00
0.00E+00
2.76E+03
Clifton North End
Bridge
7/23/2010
2.42E+03
2.90E+02
9.38E+03
0.00E+00
Clifton North End
Bridge
11/2/2010
1.32E+01
3.67E+07
0.00E+00
6.20E+01
Clifton North End
Bridge
11/2/2010
1.97E+01
0.00E+00
0.00E+00
0.00E+00
Clifton at Old Dump
Clifton at Old Dump
Clifton at Old Dump
Clifton at Old Dump
Clifton at Old Dump
Clifton at Old Dump
Clifton at Old Dump
Clifton at Old Dump
Below Morenci Gulch
Below Morenci Gulch
Below Morenci Gulch
7/1/2010
7/23/2010
11/2/2010
11/2/2010
8/1/2011
8/1/2011
11/19/2011
11/19/2011
7/21/2010
11/3/2010
11/3/2010
8.82E+01
1.73E+03
7.40E+00
5.20E+00
2.42E+03
2.42E+03
2.31E+01
2.49E+01
2.42E+03
8.50E+00
8.50E+00
9.23E+01
1.40E+03
0.00E+00
0.00E+00
3.22E+04
2.11E+02
3.59E+00
4.53E+04
6.23E+02
0.00E+00
0.00E+00
7.90E+02
8.35E+03
0.00E+00
0.00E+00
1.07E+06
1.92E+06
8.86E+05
8.26E+05
5.43E+03
0.00E+00
0.00E+00
1.25E+02
0.00E+00
2.57E+02
1.30E+02
1.07E+12
0.00E+00
3.46E+02
1.09E+02
1.33E+03
1.15E+13
0.00E+00