Download La familia de las proteínas proteolipídicas - IIB-INTECH

Document related concepts

Neurogénesis adulta wikipedia, lookup

Plasticidad neuronal wikipedia, lookup

Depresión a largo plazo wikipedia, lookup

Potenciación a largo plazo wikipedia, lookup

Hipocampo (anatomía) wikipedia, lookup

Transcript
Universidad Nacional de San Martín
Instituto de Investigaciones Biotecnológicas-INTECH-CONICET
La familia de las proteínas proteolipídicas:
estrés crónico y plasticidad neuronal
Lic. María Eugenia Fernández
Director: Dr. Alberto Carlos C. Frasch
Tesis para optar al título de Doctora en Biología Molecular y
Biotecnología
Octubre de 2008
Resumen
RESUMEN
La exposición crónica al estrés puede afectar severamente el funcionamiento del
sistema nervioso confiriendo, además, susceptibilidad a enfermedades psiquiátricas tales
como la depresión. El hipocampo es una estructura cerebral con una gran plasticidad
neuronal que resulta particularmente sensible al estrés. En distintos modelos animales se ha
visto que el estrés crónico produce alteraciones morfológicas en el hipocampo que incluyen
la retracción de las dendritas apicales de las neuronas de la zona CA3 así como la
reorganización de las terminales de las fibras musgosas. Además, el estrés crónico produce
la retracción de espinas y la pérdida de sinapsis en las neuronas de la zona CA3. Resulta
interesante destacar que el tratamiento con antidepresivos revierte los efectos del estrés
sobre el hipocampo. Los mecanismos moleculares involucrados en las alteraciones
estructurales encontradas en el hipocampo de animales sometidos a estrés crónico así como
los procesos implicados en la acción terapéutica de los antidepresivos no han sido aún
identificados.
Estudios previos de nuestro laboratorio revelaron que la expresión de la glicoproteína
de membrana 6a (M6a) en el hipocampo se encuentra modulada por la exposición al estrés
crónico y el tratamiento con antidepresivos. Por lo tanto, el primer objetivo del presente
trabajo de tesis consistió en caracterizar funcionalmente a M6a. Mediante ensayos de
ganancia y pérdida de función en cultivos primarios de neuronas de hipocampo, se
determinó que M6a juega un rol clave en la extensión de neuritas y en la formación de
filopodios/espinas pudiendo estar, además, involucrada en el establecimiento de sinapsis.
Además, se estableció que la capacidad de M6a de inducir la formación de filopodios no se
encuentra restringida a cultivos primarios de neuronas de hipocampo, sino que se extiende
a líneas neuronales como neuroblastoma 2a (N2a) y feocromocitoma 12 (PC12), y no
neuronales como COS-7. M6a pertenece a la familia de las proteínas proteolipídicas (PLPs).
En mamíferos, esta familia está integrada por M6a, la glicoproteína de membrana 6b (M6b),
PLP y su variante de splicing DM20. Al analizar los otros miembros de la familia de las PLPs,
se determinó que la expresión de la glicoproteína de membrana 6b (M6b) y DM20 en el
hipocampo también se encuentra regulada por la exposición al estrés crónico por
confinamiento en ratones. Asimismo, se vio que M6b y DM20 comparten con M6a la
capacidad de inducir la formación de filopodios en cultivos primarios de neuronas
hipocampales y en células N2a y COS-7. Por el contrario, la expresión de PLP no se encontró
1
Resumen
afectada en el hipocampo de animales sometidos a estrés crónico. Además, la
sobreexpresión de esta proteína no induce la formación de filopodios en cultivos primarios
de neuronas de hipocampo. Dado que la expresión de M6a se encuentra regulada por el
estrés crónico y los antidepresivos, y debido a su rol en plasticidad sináptica, el gen que
codifica para la proteína M6a (GPM6A) representa un candidato a tener en cuenta en
relación a neuropatologías tales como la depresión. Es por ello que durante esta tesis inició
el estudio de polimorfismos en el gen GPM6A en muestras de pacientes con depresión.
Los resultados descriptos en esta tesis sugieren que la disminución en la expresión de
M6a y M6b podría ser, en parte, responsable de las alteraciones estructurales encontradas
en el hipocampo de animales sometidos estrés crónico y que las proteínas proteolipídicas
deberían ser consideradas en enfermedades relacionadas al estrés tales como la depresión.
2
Summary
SUMMARY
Prolonged exposure to stressful situations can bring severe consequences for the
brain, conferring susceptibility to certain psychiatric disorders such as depression. The
hippocampal formation, which possesses a remarkable degree of plasticity, is particularly
sensitive to stress. Morphological alterations have been described in the hippocampus of
different animal models of chronic stress which include a reduction of apical dendritic
branching and total dendritic length in CA3 pyramidal neurons, as well as reorganization
within the mossy fiber terminals. Chronic stress has been also found to induce retraction of
thorny excrescences and loss of synapses in CA3 neurons. It is worth noting that
antidepressant treatment can prevent most of the described stress effects. The molecular
pathways underlying the plastic alteration found in the hippocampus of chronically stressed
animals as well as the mechanisms involved in the therapeutic effect of antidepressants
remain largely unknown.
Previous studies in our lab revealed that the expression of membrane glycoprotein 6a
(M6a) in the hippocampus is modulated by chronic stress and antidepressant treatment.
Therefore, the first aim of the present work was to study possible biological functions for
M6a. Through gain and loss of function approaches in cultured hippocampal neurons, we
found that M6a is a key modulator for neurite outgrowth and filopodium/spine formation
and it may also be involved in the establishment of synapses. In addition, the capacity of
M6a to induce filopodium formation was not confined to primary cultures of hippocampal
neurons but was conserved in neuronal (N2a and PC12) and non-neuronal (COS-7) cell lines.
M6a belongs to the family of proteolipid proteins. In mammals, other members of this family
include membrane glycoprotein 6b (M6b), PLP and its splice variant DM20. Then, we
analyzed other members of the proteolipid protein family we found that the expression of
membrane glycoprotein 6b (M6b) and DM20 in the hippocampus is also regulated by chronic
restraint stress in mice. In addition, we showed that M6b and DM20 can also induce
filopodium formation in hippocampal neurons, N2a and COS-7 cells. On the other hand, PLP
expression was not found to be altered in the hippocampus of chronically stressed animals.
Moreover, PLP overexpression does not induce filopodium formation in hippocampal
neurons. Given M6a expression regulation by chronic stress and antidepressants, and due to
its role in neuroplasticity, the gene coding for M6a (GPM6A) represents a candidate to be
taken into account in neuropathologies such as depression. For this reason, in this work we
3
Summary
also started analyzing polymorphisms in GPM6A in samples of patients suffering from
depression.
Our results reveal that the down-regulation in the expression of M6a and M6b may
be in part responsible for the plastic alterations found in the hippocampus of chronically
stressed animals and that proteolipid proteins should be considered in stress related
disorders such as depression.
4
Publicaciones
PUBLICACIONES
Parte de los resultados obtenidos en esta tesis han sido incluidos en los siguientes
artículos:
•
“The stress-regulated protein M6a is a key modulator for neurite outgrowth and
filopodium/spine formation”. J. Alfonso*, ME. Fernández*, B. Cooper, G. Flugge, AC.
Frasch. Proc Natl Acad Sci USA 2005 Nov 22; 102(47):17196-201.
•
“Conserved cellular function and stress-mediated regulation among members of
the proteolipid protein family”. ME. Fernández, J. Alfonso, AC. Frasch. Manuscrito
en preparación.
*Contribución ecuánime
5
Abreviaturas
ABREVIATURAS
ACTH: hormona corticotrópica
ADN: ácido desoxirribonucleico
ADNc: ácido desoxirribonucleico copia
ARN: ácido ribonucleico
ARNm: ARN mensajero
BDNF: factor neurotrófico derivado del cerebro
CA: Cornu Ammonis
CDS: región codificante
CK2: proteína quinasa CK2
CRF: factor liberador de la corticotrofina
GFP: proteína verde fluorescente
HPA: eje hipotalámico-pituitario-adrenal
LTD: depresión a largo plazo
LTP: potenciación a largo plazo
M6a: glicoproteína de membrana 6a
M6b: glicoproteína de membrana 6b
N2a: neuroblastoma 2a
PCR: reacción en cadena de la polimerasa
PLP: proteína proteolipídica
PC12: feocromocitoma 12
PKC: proteína quinasa C
PVN: núcleo paraventricular del hipotálamo
RT: retrotranscripción
SEM: error estándar de la media
SNC: sistema nervioso central
TM: transmembrana
6
Índice
ÍNDICE
1. INTRODUCCIÓN
10
1.1 El estrés crónico
10
1.2 Modelos animales de estrés crónico
13
1.3 Efectos del estrés crónico sobre el hipocampo
14
1.4 Genes regulados por el estrés y los antidepresivos
18
1.5 La glicoproteína de membrana 6 (M6a) y la familia de las proteínas
proteolipídicas (PLPs)
19
1.6 Plasticidad neuronal
21
2. OBJETIVOS
26
3. RESULTADOS
27
3.1 ESTUDIO FUNCIONAL DE LA GLICOPROTEÍNA M6a CUYA EXPRESIÓN EN EL
HIPOCAMPO ES REGULADA POR EL ESTRÉS
27
3.1.1 Localización de la proteína M6a en cultivos primarios de neuronas de
hipocampo
27
3.1.2 La sobreexpresión de M6a induce la formación de neuritas y de
filopodios/espinas
29
3.1.3 La reducción en los niveles de M6a produce una disminución en la densidad
de filopodios/espinas y en el número de puntos de sinaptofisina
3.1.4 Efectos de la sobreexpresión de M6a en líneas neuronales y no neuronales
33
36
3.1.5 La localización de M6a no depende de la integridad del citoesqueleto de
actina
39
3.1.6 La formación de filopodios inducida por M6a no estaría mediada por
proteínas GTPasas de la familia Rho
40
3.1.7 La palmitoilación y la fosforilación en los loops extracelulares de M6a no
serían necesarias para su función en la formación de filopodios
41
7
Índice
3.2 LA FAMILIA DE LAS PROTEÍNAS PROTEOLIPÍDICAS: REGULACIÓN POR EL ESTRÉS
CRÓNICO Y ROL EN LA FORMACIÓN DE FILOPODIOS
45
3.2.1 Homología entre los miembros de la familia de las PLPs
45
3.2.2 Efectos del estrés crónico sobre la expresión de los miembros de la familia de
las PLPs
46
3.2.3 Isoformas de M6b
48
3.2.4 Clonado y expresión de isoformas de M6b y PLP
50
3.2.5 M6b y DM20 inducen la formación de filopodios en cultivos primarios de
neuronas de hipocampo y en líneas celulares
3.3
53
ESTUDIO DE POLIMORFISMOS EN EL GEN QUE CODIFICA PARA LA PROTEÍNA
M6a (GPM6A) EN PACIENTES CON DEPRESIÓN
4. DISCUSIÓN
59
61
4.1 M6a y M6b podrían estar involucradas en el remodelado neuronal observado en
el hipocampo de animales estresados crónicamente
62
4.2 Evolución y homología funcional entre los miembros de la familia de las
proteínas proteolipídicas
64
4.3 Mecanismos que subyacerían la formación de filopodios mediada por las
proteínas proteolipídicas
66
4.4 M6a y la acción terapéutica de los antidepresivos
69
4.5 Polimorfismo en GPM6A asociado a síntomas de depresión
70
5. CONCLUSIONES GENERALES
73
6. PERSPECTIVAS FUTURAS
74
7. MATERIALES Y MÉTODOS
76
7.1 Cultivos celulares
76
7.2 Ensayos de inmunocitoquímica
76
7.3 Ensayos de despolimerización de la F-actina, marcación de las membranas
celulares e identificación de las células viables
7.4 Construcción de los plásmidos utilizados en las transfecciones
77
77
8
Índice
7.5 ARN de interferencia
79
7.6 Transfección de los plásmidos y el ARN de interferencia
79
7.7 Cuantificación de células, procesos neuronales y puntos de sinaptofisina
79
7.8 Ensayos de activación de GTPasas
82
7.9 Tratamiento de estrés
83
7.10 Disección de los hipocampos y extracción del ARN total
83
7.11 Purificación del ARN mensajero poli A+ y síntesis del ADN copia
84
7.12 Ensayos de PCR en tiempo real
84
7.13 Análisis de polimorfismos en el gen GPM6A en pacientes con depresión
86
8. REFERENCIAS
88
AGRADECIMIENTOS
100
9
Introducción
1. INTRODUCCIÓN
1.1 El estrés crónico
El estrés puede definirse como el estado en el que un organismo percibe
comprometida su homeostasis. Se entiende, entonces, que la amenaza puede ser o no real y
que la percepción del individuo juega un rol preponderante en la determinación del estado
de estrés. Para que una situación sea considerada estresante, el individuo debe percibirla
como alarmante, fuera de lo común y nociva u hostil (Kim et al. 2002).
La respuesta al estrés involucra la activación de los sistemas endócrino, nervioso e
inmune. Así, se producen cambios comportamentales y fisiológicos que aumentan la
probabilidad del individuo de adaptarse a la situación estresante de modo tal de alcanzar
nuevamente la homeostasis. Los cambios comportamentales incluyen mayor atención y
euforia mientras que dentro de las alteraciones fisiológicas se distinguen el aumento en el
tono cardiovascular y el ritmo respiratorio; y la supresión de los procesos de digestión,
crecimiento, reproducción e inmunidad (Smith et al. 2006).
La percepción del estrés y la respuesta al mismo representan una ventaja para el
individuo ya que le permiten adaptarse a una situación dada. Sin embargo, la exposición a
situaciones de estrés severas o prolongadas en el tiempo puede resultar dañina para el
organismo. En el humano y en otros mamíferos, la activación prolongada de la respuesta al
estrés produce hipertrofia adrenal, atrofia del timo y nódulos linfáticos, supresión del
sistema inmune y ulceraciones (Sorrells et al. 2007). Además, el estrés crónico o severo
produce daños en estructuras del sistema nervioso central como el hipocampo, la amígdala y
la corteza prefrontal, con la consecuente alteración en los procesos de aprendizaje y
memoria (de Kloet et al. 2005). Se cree que los efectos nocivos de la respuesta al estrés son
el resultado de una desregulación de los sistemas hormonales y neuronales activados
durante la misma.
En los mamíferos, el eje hipotalámico-pituitario-adrenal (HPA) es el principal sistema
involucrado en la respuesta al estrés. Este sistema neuroendócrino -posee componentes
tanto neuronales como hormonales- se encuentra representado en la figura 1. Ante la
percepción de una situación de estrés, las neuronas del núcleo paraventricular (PVN) del
hipotálamo sintetizan y secretan el factor liberador de la corticotrofina (CRF). Al unirse a su
receptor en la adenohipófisis, el CRF induce la liberación de la hormona corticotrópica
(ACTH) al sistema circulatorio la cual actúa principalmente sobre las glándulas adrenales,
10
Introducción
estimulando la liberación de glucocorticoides (Smith et al. 2006). Los glucocorticoides
(cortisol en humanos y corticosterona en roedores) son hormonas esteroideas que median
las respuestas cardiovascular y metabólica al estrés, caracterizadas por un incremento en la
presión arterial y en el ritmo cardíaco, y un aumento en la concentración de glucosa en
sangre, alcanzado por medio de una movilización desde los sitios de reserva y una supresión
de actividades anabólicas, lo que representa una mayor disposición de energía (Sapolsky et
al. 2000). De este modo, la activación del eje HPA ante un estado de estrés le permite al
individuo adaptarse a la nueva situación. Sin embargo, la hiperactivación de este sistema
puede resultar perjudicial para la salud del individuo por lo que éste se encuentra finamente
regulado. Se cree que la desregulación del eje HPA es responsable de los efectos nocivos de
la exposición prolongada a situaciones de estrés.
Hipocampo
Hipocampo
Amígdala
Hipófisis
Glucocorticoides
Corteza adrenal
Figura 1. Eje hipotalámico-pituitario-adrenal. Las neuronas del núcleo paraventricular (PVN) del hipotálamo
integran la información relevante al estrés mediante conexiones con la amígdala y el hipocampo, que
representan aferentes excitatorios e inhibitorios respectivamente. Estas neuronas secretan el factor liberador
de la corticotrofina (CRF), el cual es transportado a través de los capilares del sistema circulatorio hacia la
hipófisis. Las células corticotróficas de la adenohipófisis liberan adenocorticotrofina (ACTH) al torrente
sanguíneo que al alcanzar la corteza de las glándulas suprarrenales, estimula la secreción de glucocorticoides.
Además de otras numerosas funciones, los glucocorticoides inhiben la síntesis y liberación de CRF y ACTH,
regulando su propia liberación. Niveles muy altos de glucocorticoides pueden resultar dañinos para las
neuronas del hipocampo, interfiriendo con el sistema de inhibición sobre el hipotálamo, produciéndose así un
estado de hipercortisolemia. Adaptado de Nestler et.al., 2002.
11
Introducción
El eje HPA se encuentra regulado tanto a nivel endócrino como a nivel neuronal. En
cuanto a la regulación endócrina, niveles elevados de glucocorticoides inhiben la actividad
del sistema actuando sobre el hipotálamo y la hipófisis en un clásico modelo de
retroalimentación negativa. A nivel neuronal, la actividad del eje HPA se encuentra regulada
por distintos circuitos neuronales: proyecciones aferentes del hipocampo inhiben la
liberación de CRF en el PVN mientras que las inervaciones de la amígdala la estimulan (Smith
et al. 2006).
La hiperactividad del eje HPA es un hallazgo frecuente en animales sometidos a
estrés crónico y en pacientes con depresión (Watanabe et al. 1992; Holsboer 2001; van
Kampen et al. 2002; de Kloet et al. 2005). Se cree que el hipocampo juega un rol
preponderante en la desregulación de este sistema. Se ha demostrado que altos niveles de
glucocorticoides pueden causar daños en las neuronas del hipocampo, lo que reduciría la
inhibición que el hipocampo ejerce sobre el eje HPA. De este modo, se incrementarían los
niveles de glucocorticoides, lo que aumentaría el daño en el hipocampo conformándose un
circuito patológico de retroalimentación positiva (Nestler et al. 2002).
Varios estudios han demostrado una relación causal entre la exposición a situaciones
de estrés y el desarrollo de la depresión (Kessler 1997; Kendler et al. 1999; Paykel 2001). La
depresión es un trastorno del estado anímico en el cual los sentimientos de tristeza, pérdida,
ira o frustración interfieren con la vida diaria durante un período prolongado. Conocida en
sus inicios con el nombre de melancolía, término empleado por Hipócrates alrededor de 400
años AC, los síntomas de la depresión aparecen descriptos en numerosos tratados médicos
de la antigua Grecia (Nestler et al. 2002). En la actualidad, 121 millones de personas sufren
de depresión mayor y esta enfermedad se ha convertido en la principal causa de
discapacidad a nivel mundial. Además, debido a la alta incidencia de suicidios en los
enfermos, se estima que para el año 2020 la depresión ocupe el segundo lugar, detrás de las
enfermedades cardiovasculares, en el índice DALY (del inglés Disability Adsusted Life Years)
que mide los años de vida saludables perdidos por muerte prematura o discapacidad
(http://www.who.int/mental_health/management/depression/definition/en/).
Los tratamientos para la depresión incluyen la administración de medicamentos
antidepresivos, la psicoterapia y/o la terapia electroconvulsiva. En los últimos años se han
producido pequeños avances en los tratamientos para esta enfermedad, especialmente
debido a la disminución de efectos secundarios de los medicamentos de segunda
12
Introducción
generación. Sin embargo, los tratamientos distan de ser satisfactorios: apenas el 50 % de los
pacientes tratados con antidepresivos, solamente o en conjunto con psicoterapias, muestran
remisión total a la enfermedad (Berton et al. 2006). La falta de tratamientos adecuados se
debe al desconocimiento de los procesos neurobiológicos que subyacen la depresión así
como a la ignorancia de los mecanismos responsables de los efectos terapéuticos de las
drogas antidepresivas.
Además de los factores ambientales, tales como la exposición al estrés, el origen de
la depresión presenta un componente genético (Fava et al. 2000). A pesar de los grandes
esfuerzos realizados, todavía no se han identificado las bases genéticas de la enfermedad. La
dificultad radicaría, al igual que para otras enfermedades complejas como la esquizofrenia,
en la participación de varios genes en la etiología de este trastorno (Burmeister 1999).
1.2 Modelos animales de estrés crónico
Dada la relación causal encontrada entre la exposición al estrés y el desarrollo de la
depresión en humanos (Kessler 1997; Kendler et al. 1999; Paykel 2001), varios modelos
animales de estrés crónico han sido desarrollados. Dos modelos de estrés crónico
ampliamente utilizados son el de estrés psicosocial en Tupaia belangeri, comúnmente
conocida como musaraña arborícola (van Kampen et al. 2002) y el de estrés por
confinamiento en roedores (Watanabe et al. 1992).
Los individuos machos de la especie T. belangeri, que filogenéticamente se encuentra
entre los insectívoros y los primates, poseen un fuerte instinto de territorialidad. Esta
característica es utilizada en el modelo de estrés psicosocial para establecer una relación
conflictiva entre dos individuos de la especie. El diseño experimental consiste en la
habituación de dos machos, uno naive y otro socialmente experimentado, cada uno a un
espacio dentro de una misma jaula dividida por una superficie opaca que no permite la
visualización entre los mismos. Luego, la superficie divisoria es retirada y se produce una
competencia por el control del nuevo territorio ampliado, estableciéndose naturalmente una
relación de dominancia y subordinación entre los individuos. Los animales naive resultan ser
siempre los subordinados. Una vez establecida la dominancia, la jaula se divide nuevamente
con una malla metálica que permite la visualización entre los mismos. La malla metálica es
removida diariamente, durante tres o cuatro semanas, por un período de sólo noventa
minutos de forma tal de permitir el contacto físico entre los animales. De este modo, el
animal subordinado es protegido de reiterados ataques, sin embargo, al encontrarse
13
Introducción
constantemente expuesto a claves olfativas, visuales y auditivas del individuo dominante,
despliega un comportamiento típico de subordinación (van Kampen et al. 2002).
La validez del modelo de estrés psicosocial crónico en T. belangeri como modelo de
depresión se encuentra asociada a dos características fundamentales. En primer lugar, los
síntomas que presentan los individuos subordinados son similares a los que presentan los
pacientes con depresión, destacándose entre ellos la pérdida de peso y apetito, disturbios
en el sueño, y la reducción en la locomoción y el aseo. Además, se observa una alta
concentración de cortisol en sangre indicativo de una desregulación del eje HPA. Sin
embargo, cabe mencionar que los síntomas clave en el diagnóstico de la depresión, como el
estado de ánimo deprimido, la pérdida del interés o los pensamientos recurrentes de
muerte no son evaluables en modelos animales. En segundo lugar, el tratamiento con
antidepresivos como la clomipramina revierte los síntomas observados en los animales
estresados (van Kampen et al. 2002).
Otro modelo de estrés crónico frecuentemente utilizado es el de inmovilización en
roedores. El procedimiento, que se aplica tanto en ratones como en ratas, consiste en la
inmovilización diaria del animal por confinamiento en tubos de plástico aireados por
períodos de entre cuatro y seis horas durante un lapso de tres semanas. Se ha demostrado
que este tratamiento produce una disminución en la ganancia de peso, un aumento en el
peso de las glándulas adrenales indicativo de hipertrofia adrenal y un incremento en la
concentración de corticosterona en sangre que indica la desregulación del eje HPA
(Watanabe et al. 1992).
1.3 Efectos del estrés crónico sobre el hipocampo
El hipocampo es una de las estructuras cerebrales más afectadas en animales
sometidos a estrés crónico. La formación hipocampal juega un rol clave en la memoria
declarativa y en el proceso de aprendizaje (Manns et al. 2006) por lo que se cree que las
alteraciones encontradas en el hipocampo de animales sometidos a estrés crónico serían
responsables de los problemas cognitivos que presentan los mismos (McEwen 2004).
La formación hipocampal se encuentra en el lóbulo temporal medio y conforma el
sistema límbico. Las neuronas del hipocampo se encuentran particularmente alineadas por
lo que se pueden distinguir capas compuestas predominantemente por dendritas apicales,
somas celulares, dendritas basales y axones. La formación hipocampal se encuentra dividida
en regiones, denominadas las zonas Cornu Ammonis CA1-CA4, el giro dentado y el
14
Introducción
subiculum. Como se muestra en la figura 2, la información fluye en el hipocampo desde el
giro dentado, a través de las zonas CA3 y CA1, hacia el subiculum. La entrada de información
se produce principalmente a través de la vía perforante compuesta por axones provenientes
de la corteza entorrinal que atraviesan el subiculum y llegan hasta las células granulares del
giro dentado donde establecen contacto sináptico. Los axones de las neuronas del giro
dentado conforman las fibras musgosas haciendo sinapsis con las neuronas piramidales de la
zona CA3. La información luego fluye hacia las neuronas piramidales de la zona CA1 a través
de las fibras colaterales de Schaffer. Los axones de las neuronas de la zona CA1 proyectan
hacia el subiculum y la corteza entorrinal constituyendo la principal vía de salida de
información del hipocampo.
Neuronas
piramidales
de la CA1
Fibras colaterales de
Schaffer
Neuronas
piramidales
de la CA3
Axones de las neuronas de la CA1
(hacia subiculum y corteza
entorrinal)
CA1
CA3
GD
Fibras musgosas
Vía perforante
(axones de la
corteza entorrinal)
Neuronas granulares del
giro dentado
Figura 2. Vías sinápticas del hipocampo. La información ingresa al hipocampo a través de la vía
perforante, que se origina en la corteza entorrinal y pasa por el subiculum hasta llegar a las
células granulares del giro dentado (GD). Los axones de estas células proyectan hacia las
dendritas de las neuronas piramidales de la zona CA3, constituyendo la vía de las fibras
musgosas. Las neuronas de la zona CA3 envían colaterales excitatorios a las neuronas piramidales
de la zona CA1, formando la vía de las fibras colaterales de Schaffer. Finalmente, axones de las
neuronas de la zona CA1 proyectan al subiculum y las capas profundas de la corteza entorrinal,
en la principal vía de salida de información del hipocampo. Existen vías secundarias de entrada y
salida de información del hipocampo que no se encuentran representadas.
15
Introducción
El hipocampo posee una gran plasticidad neuronal, entendiéndose por ésta la
capacidad que tiene el sistema nervioso de remodelar los contactos entre neuronas y la
eficiencia de sus sinapsis. Entre las bases celulares de la plasticidad neuronal en el
hipocampo adulto, se encuentran los cambios en la eficiencia de las conexiones sinápticas,
la formación de nuevas sinapsis así como también la eliminación de sinapsis preexistentes y
la generación de nuevas neuronas (proceso conocido como neurogénesis). Estos
mecanismos subyacen los procesos de aprendizaje y memoria, siendo la plasticidad neuronal
de vital importancia para que el organismo responda a constantes cambios en el ambiente
(McClung et al. 2008). Sin embargo, la neuroplasticidad no siempre resulta beneficiosa ya
que alteraciones estructurales observadas en el hipocampo de animales sometidos a estrés
crónico, así como en pacientes con depresión, han sido asociadas con problemas cognitivos
(McEwen 2004).
Entre las alteraciones más frecuentemente observadas en el hipocampo de animales
estresados crónicamente se encuentra la reducción en el largo y en la ramificación de las
dendritas apicales de las neuronas piramidales de la zona CA3. Este fenómeno ha sido
observado tanto en individuos de la especie T. belangeri sometidos a estrés psicosocial como
en ratas estresadas por inmovilización (Watanabe et al. 1992; Magarinos et al. 1996).
Resulta interesante destacar que el tratamiento con drogas antidepresivas como la
tianeptina previene las modificaciones estructurales mencionadas en ambos modelos
animales (Watanabe et al. 1992; Magarinos et al. 1999). Otros estudios de estrés crónico en
roedores revelan, además, la retracción de estructuras tipo espinas y una disminución en el
número de sinapsis en la zona CA3 del hipocampo (Sousa et al. 2000; Sandi et al. 2003;
Stewart et al. 2005). También se ha descripto una reorganización en las terminales de las
fibras musgosas caracterizada por una reducción en su superficie y en el número de
contactos sinápticos con las neuronas piramidales de la zona CA3 en el hipocampo de ratas
estresadas crónicamente (Magarinos et al. 1997; Sousa et al. 2000).
La neurogénesis en el giro dentado del hipocampo también se encuentra modulada
por la exposición crónica al estrés y el tratamiento con antidepresivos. El estrés crónico
suprime la proliferación y supervivencia de nuevas neuronas granulares en el hipocampo
ratas y de machos adultos de la especie T. belangeri (Gould et al. 1997; Pham et al. 2003;
Duman 2004; Heine et al. 2004). En contraste, la administración de drogas antidepresivas
aumenta la neurogénesis en animales no estresados (Malberg et al. 2000; Manev et al. 2001)
16
Introducción
y revierte el efecto inhibitorio observado en el hipocampo de animales sometidos a estrés
crónico (Czeh et al. 2001).
Las alteraciones observadas en el hipocampo de animales estresados crónicamente,
como la retracción dendrítica y la inhibición de la neurogénesis, podrían explicar la reducción
en el volumen de la formación hipocampal encontrada en individuos de la especie T.
belangeri sometidos a estrés psicosocial (Ohl et al. 2000). Además, la disminución en el
volumen del hipocampo observada en pacientes con depresión, la cual ha sido asociada a
problemas cognitivos (MacQueen et al. 2003), también podría responder a modificaciones
estructurales como las mencionadas.
Se cree que las alteraciones plásticas encontradas en el hipocampo de animales
estresados crónicamente son consecuencia de los elevados niveles de glucocorticoides.
Diversos estudios han demostrado que la simple administración de corticosterona induce la
retracción de las dendritas apicales de las neuronas piramidales de la zona CA3 e inhibe la
neurogénesis en el giro dentado del hipocampo de rata (Woolley et al. 1990; Cameron et al.
1994; Magarinos et al. 1995).
El hipocampo posee una alta densidad de receptores para glucocorticoides, motivo
por el cual esta estructura resultaría particularmente sensible a la acción de los mismos. Se
han descripto dos tipos de receptores para estas hormonas esteroideas, los cuales
colocalizan en la formación hipocampal. Los receptores de tipo I o de mineralocorticoides
son de alta afinidad mientras que los receptores de tipo II o de glucocorticoides son de baja
afinidad. Los receptores de glucocorticoides, siendo de baja afinidad, son ocupados por las
hormonas esteroideas solamente ante una alta concentración de las mismas. Por este
motivo, se cree que los receptores de tipo II mediarían los efectos provocados por altos
niveles de glucocorticoides. Ambos tipos de receptores poseen una localización
citoplasmática, activándose y translocándose al núcleo ante la unión de sus ligandos. En el
núcleo, los complejos hormona-receptor regulan la transcripción de genes por distintas vías.
Homodímeros y heterodímeros de los receptores se unen a los promotores de genes que
poseen secuencias GRE (del inglés glucocorticoid responsive elements) activando o
inhibiendo su transcripción según la secuencia GRE y el reclutamiento de factores
activadores o represores. Además, monómeros de los receptores de tipo II pueden unirse a
otros factores de transcripción inhibiendo su acción reprimiendo así la expresión de genes
(De Kloet et al. 1998; de Kloet et al. 2005). La alteración en la expresión génica podría
17
Introducción
subyacer los mecanismos por los cuales altos niveles de glucocorticoides provocan
remodelaciones estructurales en el hipocampo, como ser la retracción de dendritas o la
inhibición de la neurogénesis. Se han identificado algunos genes cuya expresión en el
hipocampo se encuentra regulada por glucocorticoides tales como el gen que codifica para
el factor neurotrófico derivado del cerebro (BDNF, del inglés, Brain Derived Neurotrophic
Factor) y la neurotrofina 3 (Smith et al. 1995), isoformas polisialidadas de la molécula de
adhesión neuronal PSA-NCAM (Rodriguez et al. 1998) y la proteína quinasa dependiente de
calcio y calmodulina CaMK-VI (Vreugdenhil et al. 2001). Sin embargo, los mecanismos
moleculares responsables de las alteraciones plásticas mencionadas no han sido aún
dilucidados.
1.4 Genes regulados por el estrés y los antidepresivos
Los mecanismos implicados en las alteraciones estructurales encontradas en el
hipocampo de animales sometidos a estrés crónico todavía no han sido esclarecidos.
Asimismo, los procesos involucrados en la acción terapéutica de los antidepresivos no han
sido identificados. La comprensión de estos mecanismos podría resultar de gran utilidad
para el entendimiento y el tratamiento de enfermedades relacionadas al estrés como la
depresión. Los avances científicos tecnológicos, y en particular en la biología molecular,
permiten hoy la identificación de genes cuya expresión se encuentra modulada por la
exposición al estrés y la administración de drogas antidepresivas. La identificación de estos
genes es clave para entender las bases moleculares del estrés y el tratamiento con
antidepresivos, motivo por el cual varios grupos de investigación, incluyendo nuestro
laboratorio, se han concentrado en su identificación.
Varios genes de expresión diferencial en tratamientos de estrés y antidepresivos han
sido identificados. Según la función de sus productos proteicos, los genes encontrados
pueden agruparse en categorías. Así, se han identificado genes relacionados al eje HPA como
son los receptores de glucocorticoides de tipo I y II y CRF; genes que codifican para factores
de transcripción o proteínas involucradas en la traducción de señales, por ejemplo CREB;
factores de crecimiento o diferenciación neuronal como BDNF y NGF (del inglés, Nerve
Growth Factor); proteínas involucradas en la sistemas de neurotransmisión tales como los
receptores de serotonina; y factores clave en la formación de sinapsis y terminaciones
nerviosas como la sinaptofisina y la sinaptotagmina (Alfonso et al. 2005).
18
Introducción
A pesar de la gran cantidad de genes cuya expresión se encuentra modulada por el
estrés y los antidepresivos identificados, las bases moleculares de las alteraciones plásticas
observadas en el hipocampo de animales estresados y de la acción terapéutica de los
antidepresivos, no han sido del todo esclarecidas. Los mecanismos que subyacen ambos
procesos son complejos y, por consiguiente, se cree que todavía falta identificar un gran
número de genes. Una vez identificados, el desafío será integrar toda la información para
entender las consecuencias celulares y fisiológicas de su expresión diferencial.
1.5 La glicoproteína de membrana 6a (M6a) y la familia de las proteínas proteolipídicas
(PLPs)
Con el objeto de identificar genes cuya expresión se encuentra regulada por el estrés
crónico, en nuestro laboratorio se utilizaron bibliotecas sustractivas que representan un
método no sesgado u orientado por una pre-selección de genes. Las bibliotecas sustractivas
fueron construidas con muestras de ácido ribonucleico mensajero (ARNm) provenientes de
hipocampos de animales de la especie T. belangeri tratados crónicamente con cortisol y
animales sin tratar, utilizados como control (Alfonso et al. 2004). Luego, varios de los genes
identificados en las bibliotecas sustractivas fueron evaluados en el modelo de estrés
psicosocial de T. belangeri confirmándose, por reacción en cadena de la polimerasa (PCR) en
tiempo real, la expresión diferencial de cinco genes (Alfonso et al. 2004). Entre los genes
identificados se distingue la glicoproteína de membrana 6a (M6a), cuya expresión resultó
disminuida en el hipocampo de animales estresados psicosocialmente, siendo este efecto
revertido por la admisitración de clomipramina (antidepresivo tricíclico que inhibe la
captación neuronal de serotonina y noradrenalina). La expresión de M6a también se
encontró reducida en ratones de distintas cepas y ambos sexos sometidos a estrés crónico
por inmovilización. De modo similar a lo observado en individuos de la especie T. belangeri,
el tratamiento con tianeptina (antidepresivo atípico que activa la recaptación de serotonina)
en ratones contrarrestó los efectos del estrés sobre los niveles de expresión de M6a en el
hipocampo (Alfonso et al. 2006).
La proteína M6a, de alta expresión en el sistema nervioso central (SNC), ha sido
identificada hace más de 20 años (Yan et al. 1993). En estadíos embrionarios, M6a se
expresa en neuronas post-mitóticas del cerebro y la médula espinal, mientras que en el
cerebro murino adulto, la expresión de M6a se observa en el hipocampo, la corteza cerebral
y las células granulares del cerebelo (Yan et al. 1996). En el hipocampo de rata adulta, el
19
Introducción
ARNm de M6a se encuentra en el soma de las neuronas granulares del giro dentado y en las
neuronas piramidales de las regiones CA1 y CA3. Sin embargo, la proteína no se localiza en
los cuerpos celulares, sino en regiones de alta densidad sináptica, como las terminaciones de
las fibras musgosas y el hilus (Alfonso et al. 2005). En un trabajo reciente se demostró que en
el cerebro de rata adulta la proteína M6a se localiza más específicamente en los axones de
las neuronas del giro dentado que conforman la vía de las fibras musgosas (Cooper et al.
2008).
Al momento de iniciar este trabajo de tesis era escasa la información respecto a la
función de M6a. Sólo existían dos trabajos que sugerían un rol para esta proteína en la
extensión de neuritas y en la diferenciación neuronal (Lagenaur et al. 1992; Mukobata et al.
2002). Mientras se realizaba esta tesis, se publicaron dos artículos sugiriendo un papel para
M6a en la endocitosis y el reciclado del receptor de opioides (Wu et al. 2007; Liang et al.
2008). Por otro lado, publicaciones recientes sugieren que M6a tendría un rol clave en la
diferenciación neuronal a partir de células madres embrionarias (Michibata et al. 2008) y en
la extensión de neuritas en células de la retina (Zhao et al. 2008). Además, resulta
interesante destacar que se ha encontrado una asociación entre un polimorfismo en el gen
que codifica para la proteína M6a y un grupo de individuos con síntomas de depresión entre
pacientes diagnosticados con esquizofrenia (Boks et al. 2007)
M6a pertenece a la familia de las proteínas proteolipídicas (PLPs) que en mamíferos
también incluye a la glicoproteína de membrana 6b (M6b), y PLP, proteína que da nombre a
la familia. (Yan et al. 1993). Estas proteínas presentan una alta homología entre sí y según
modelos de predicción topográfica comparten una estructura representada en la figura 3,
compuesta por cuatro dominios transmembrana (TM), separados por tres loops hidrofílicos,
con los extremos amino y carboxilo terminales en el citoplasma. (Popot et al. 1991; Yan et al.
1993). La estructura propuesta para los miembros de la familia PLP se asemeja a la de las
proteínas pertenecientes a la gran familia de las tetraspaninas. Sin embargo, la secuencia
CCG (cisteína-cisteína-glicina) presente en el loop extracelular mayor del 100 % de las
tetraspaninas no se encuentra en estas proteínas y no han sido clasificadas como miembros
de esta gran familia (Stipp et al. 2003).
20
Introducción
EC 2
EC 1
EXTRACELULAR
TM
1
TM
2
TM
3
TM
4
INTRACELULAR
NH2
IC
COOH
Figura 3. Estructura propuesta para los miembros de la familia PLP. El esquema muestra la
estructura de las PLPs según modelos de predicción topográfica. Se observan cuatro dominios
transmembrana (TM1-TM4), un loop extracelular menor (EC1), un loop intracelular (IC) y un loop
extracelular mayor (EC2) con los extremos amino (NH2) y carboxilo (COOH) terminales dentro del
compartimiento intracelular.
En el SNC, M6a sólo se expresa en neuronas, M6b tanto en neuronas como en glía y
PLP sólo en glía (Yan et al. 1996). M6b fue identificada conjuntamente con M6a y varios años
después, distintas isoformas de M6b fueron descriptas (Werner et al. 2001). Sin embargo,
hasta el momento no se le ha asignado función alguna a M6b. Por otro lado, PLP fue
identificada hace más de 50 años (Folch et al. 1951). PLP, y su variante de splicing DM20,
constituyen las proteínas más abundantes en la mielina del SNC y se sabe que una de las
funciones de estas proteínas es mantener la estructura y la integridad de la mielina (Duncan
et al. 1987; Boison et al. 1994; Boison et al. 1995). Además, se les ha asignado a PLP y DM20
un rol en la diferenciación y supervivencia de oligodendrocitos (Yang et al. 1997; Nadon et
al. 1998). Asimismo, varios trabajos sugieren una función alternativa aún no identificada,
especialmente para DM20 (Knapp 1996; Nadon et al. 1997).
1.6 Plasticidad neuronal
La plasticidad neuronal, también conocida como neuroplasticidad, se refiere a la
capacidad del sistema nervioso de adaptarse y de cambiar a través del tiempo. Dado el rol
21
Introducción
sugerido para M6a en la extensión de neuritas y diferenciación neuronal (Lagenaur et al.
1992; Mukobata et al. 2002), esta proteína podría estar involucrada en procesos de
plasticidad neuronal.
Durante largo tiempo el cerebro adulto ha sido considerado estable e inmodificable,
excepto por la declinación inevitable que ocurre con el envejecimiento. Sin embargo, existen
hoy claras evidencias de cambios estructurales en el cerebro adulto que incluyen la
generación de nuevas neuronas y otras células cerebrales, así como la modificación en las
conexiones entre neuronas. Se distinguen dos tipos de plasticidad neuronal. La plasticidad
estructural se refiere a alteraciones en la morfología de procesos neuronales (tanto axones
como dendritas y principalmente sus espinas), la formación y eliminación de sinapsis, y la
generación de nuevas neuronas por el proceso denominado neurogénesis. La plasticidad
sináptica, en cambio, describe las alteraciones en la transmisión sináptica a través de
cambios en la eficiencia de sinapsis preexistentes. Como se mencionó anteriormente, la
plasticidad neuronal resulta clave para los procesos de aprendizaje y memoria,
permitiéndole al individuo adaptarse a constantes cambios en el ambiente (McClung et al.
2008).
Las espinas dendríticas son pequeñas protrusiones que emergen de las dendritas
neuronales y conforman el componente post sináptico de la gran mayoría de las sinapsis
excitatorias en el cerebro. Estas estructuras presentan un alto grado de plasticidad
estructural y tanto la aparición y desaparición de espinas dendríticas, como cambios
morfológicos en las mismas, han sido repetidamente reportados en el cerebro adulto de
roedores (Alvarez et al. 2007; Harms et al. 2007). La vida media de estas espinas, o sea su
estabilidad, aumenta conforme avanza la edad del individuo y varía según el área del
cerebro estudiada (Trachtenberg et al. 2002; Holtmaat et al. 2005; Zuo et al. 2005). Sin
embargo, espinas dendríticas mótiles y transientes son frecuentemente observadas en el
cerebro de animales adultos. La mayoría de estas espinas son inestables y desaparecen al
corto tiempo de haber aparecido mientras que un reducido porcentaje de las mismas
establece contactos sinápticos permaneciendo estables durante, al menos, varios días (Zito
et al. 2004). Estudios in vivo han demostrado que la estabilidad de las espinas dendríticas
puede ser alterada por la estimulación y la deprivación sensorial. Asimismo, en sistemas in
vitro se ha demostrado que un aumento en la actividad sináptica resulta en alteraciones en
el número y en la morfología de las espinas dendríticas (Alvarez et al. 2007; Harms et al.
22
Introducción
2007). Si bien se ha demostrado que durante el desarrollo las espinas dendríticas están
involucradas en el proceso de sinaptogénesis (Ziv et al. 1996; Fiala et al. 1998), las
consecuencias funcionales de esta plasticidad estructural en el cerebro adulto no han sido
reveladas. Sin embargo, se especula que la plasticidad estructural en las espinas dendríticas
podría participar en procesos de formación y eliminación de sinapsis.
Se han identificado varios componentes moleculares que regulan la formación y la
motilidad de las espinas. No resulta llamativo que la mayoría de estas moléculas actúe sobre
el citoesqueleto de actina que constituye la base de la morfología y la estabilidad de la
espina. En este sentido, miembros de la familias de GTPasas pequeñas (RhoA, Rac1 y
Cdc42), que son reguladores clave del citoesqueleto de actina, han sido implicados en la
formación y en la morfología de las espinas dendríticas (Newey et al. 2005). Asimismo, varios
reguladores y efectores de estas proteínas han sido identificados (Calabrese et al. 2006).
Otras moléculas involucradas en la estructura y la estabilidad de las espinas son proteínas
del citoesqueleto como las profilina, cortactina, debrina y Homero (Kennedy et al. 2005) así
como la neurabina y la espinofilina (Ryan et al. 2005). Además, la pérdida de la miosina Va y
la miosina VI también altera el número y la longitud de las espinas (Takagishi et al. 1996;
Osterweil et al. 2005).
Recientemente, se ha observado plasticidad estructural en los axones de animales
adultos. En este sentido, distintos tipos de alteraciones morfológicas han sido descriptas. En
primer lugar, se ha observado la ramificación lateral de los axones. Además, se ha
determinado la aparición y desaparición de botones sinápticos en passant en axones
preexistentes. Por último, se ha observado la remodelación de botones sinápticos
terminales. Al igual que sucede con la plasticidad en las espinas dendríticas, el remodelado
en los axones disminuye con la edad y existe una gran variabilidad según la población
neuronal estudiada. Además, la mayoría de los botones sinápticos que aparecen son
transientes y desaparecen a corto plazo. El remodelado estructural de los axones podría
provocar un rearreglo en los contactos sinápticos que podría subyacer procesos de
aprendizaje. En concordancia, se ha observado una expansión en las terminales de las fibras
musgosas en la zona CA3 del hipocampo en animales sometidos a ensayos de aprendizaje
espacial (Gogolla et al. 2007).
23
Introducción
La neurogénesis, es decir, la generación de nuevas neuronas ha sido observada en el
cerebro adulto de varios mamíferos incluyendo al hombre. Específicamente, este fenómeno
ha sido consistentemente reportado en dos regiones: en la zona sub-ventricular que
proyecta hacia el bulbo olfatorio y en el giro dentado del hipocampo (van Praag et al. 2002;
Carleton et al. 2003). El proceso de neurogénesis involucra la proliferación de células
multipotenciales, la migración y la maduración de la neurona. En el hipocampo, la
proliferación ocurre en la zona subgranular, entre la capa de células granulares y el hilus. El
50% de las células recién formadas mueren y desaparecen. Las sobrevivientes pueden
transformarse en células neuronales o de la glía, según a donde migren y según la actividad
en esa zona del cerebro en ese momento. En la neurogénesis hipocampal, los precursores
neuronales migran hacia la capa de las células granulares donde finalmente maduran,
adquiriendo las características morfológicas y fisiológicas de una neurona granular adulta.
Desde el momento que nace la célula hasta que se integra funcionalmente en el cerebro
transcurre más de un mes (Gage 2004).
El proceso de neurogénesis se encuentra finamente regulado en sus distintas etapas.
Se han identificado factores que regulan la proliferación tales como Sonic hedgehog
(Mervaala et al. 2000), así como factores que influyen sobre el destino de la célula recién
formada, es decir la diferenciación hacia célula neuronal o de la glía. Por ejemplo, se
determinó que la proteína BMP (del inglés, bone morphogenetic protein) promueve la
conversión hacia células gliares mientras que Noggin estimula la diferenciación hacia células
neuronales (Lim et al. 2000). Una vez que la célula comienza a diferenciarse hacia una célula
neuronal, otros factores resultan clave para su supervivencia y maduración entre los cuales
se destacan los factores de crecimiento IGF (del inglés, insulin-like growth factor) y BDNF
(Aberg et al. 2000; Chan et al. 2008). Los factores presentes en el nicho de maduración de
los precursors neuronales resultan clave para la supervivencia y funcionalidad de las nuevas
células. En concordancia, la remoción de células multipotenciales, su amplificación in vitro y
transplante en el cerebro adulto sólo resulta exitosa cuando la reinserción se realiza en los
sitios donde la neurogénesis ocurre normalmente en el cerebro, es decir en el hipocampo y
en el bulbo olfatorio (Gage 2000).
La neurogénesis en el hipocampo también se encuentra regulada por factores
ambientales. El traslado de un ratón de una jaula sencilla hacia un ambiente enriquecido
resulta en un incremento en el número de nuevas neuronas mediante una reducción en el
número de células que mueren (Brown et al. 2003). Además, se ha visto que los animales
24
Introducción
que corren en una rueda muestran un aumento en el número de células que se dividen,
resultando en un mayor número de nuevas neuronas (van Praag et al. 1999). Por otro lado,
como se mencionó anteriormente, la exposición crónica a situaciones de estrés disminuye la
neurogénesis en el hipocampo (Duman 2004).
En la actualidad, es ampliamente aceptado que toda experiencia modifica el
comportamiento posterior a través de modificaciones en la transmisión sináptica. La
plasticidad sináptica se refiere específicamente a la modificación en la fuerza o eficacia de la
transmisión sináptica dada por la actividad de la misma. En este sentido, la potenciación a
largo plazo (LTP, del inglés, Long Term Potentiation) y la depresión a largo plazo (LTD, del
inglés, Long Term Depression) describen cambios en la eficiencia de la transmisión sináptica
en respuesta a una estimulación dada y han sido propuestas como los mecanismos
responsables de la formación de la memoria. La LTP se produce ante una activación sináptica
breve e intensa. En cambio, la producción de una LTD requiere una estimulación más débil y
durante un período de tiempo más prolongado. Estos fenómenos han sido ampliamente
estudiados en cortes de hipocampo, principalmente en sinapsis excitatorias de la zona CA1,
sin embargo, manifestaciones similares han sido observadas en sinapsis excitatorias en
varias áreas del cerebro (Citri et al. 2008; McClung et al. 2008).
Existe hoy extensa bibliografía describiendo los mecanismos que operan en el
establecimiento de la LTP y, en menor medida, la LTD. Resulta interesante destacar que
varios mecanismos moleculares son compartidos por ambos procesos (Citri et al. 2008). El
factor de crecimiento BDNF ha demostrado ser clave en el establecimiento de la LTP (Hu et
al. 2008). También se han identificado un gran número de genes cuya expresión mediaría los
procesos de LTP y LTD (McClung et al. 2008). Además de la modulación de la transcripción
mediada por factores de transcripción tales como CREB (del inglés, cAMP response elementbinding protein), FosB y
NF-B, eventos de traducción local a partir de transcriptos
preexistentes en sinaptosomas han sido descriptos como resultado de la actividad sináptica
y podrían ser clave en el establecimiento de la LTP y la LTD (Klann et al. 2004).
Si bien la mayoría de los estudios de LTP y LTD han sido realizados in vitro,
recientemente se ha demostrado la LTP in vivo en el hipocampo, encontrándose además una
correlación con los procesos de aprendizaje y memoria (Pastalkova et al. 2006; Whitlock et
al. 2006). Asimismo, eventos de LTD han sido observados en corteza somatosensorial en
respuesta a deprivación sensorial (Allen et al. 2003).
25
Objetivos
2. OBJETIVOS
La identificación y caracterización de genes del hipocampo cuya expresión se
encuentra modulada por el estrés crónico podría resultar clave para el establecimiento de
las bases moleculares del estrés. En nuestro laboratorio se ha identificado a M6a como una
proteína cuya expresión es regulada por tratamientos de estrés y antidepresivos. El objetivo
general del presente trabajo fue caracterizar funcionalmente a M6a determinando, de ser
posible, las consecuencias celulares, fisiológicas y funcionales de la disminución en la
expresión de este gen bajo condiciones de estrés crónico. También se propuso analizar el rol
de otros miembros de la familia de las PLP en relación al estrés. De este modo, se pretendió
contribuir al entendimiento de los mecanismos implicados en la respuesta al estrés crónico.
Los objetivos particulares del presente trabajo de tesis fueron:
•
Caracterizar funcionalmente a M6a, investigando la función biológica de esta proteína en
neuronas del hipocampo.
•
Evaluar el efecto del estrés crónico sobre el nivel de expresión en el hipocampo de otros
miembros de la familia de las PLPs.
•
Estudiar si existe una función biológica conservada entre distintos miembros de la familia
de las PLPs.
•
Evaluar si existe una asociación entre el gen que codifica para la proteína M6a (GPM6A) y
pacientes con depresión.
26
Resultados
3. RESULTADOS
3.1 ESTUDIO FUNCIONAL DE LA GLICOPROTEÍNA M6a CUYA EXPRESIÓN EN EL HIPOCAMPO
ES REGULADA POR EL ESTRÉS
La expresión de M6a en el hipocampo se encuentra regulada por el estrés crónico y el
tratamiento con antidepresivos (Alfonso et al. 2004; Alfonso et al. 2006). A pesar de su
identificación hace varios años, al iniciar este trabajo de tesis la función biológica de la
proteína M6a era aún desconocida (Yan et al. 1993). Dos trabajos sugerían que M6a podría
estar involucrada en la extensión de neuritas y la diferenciación neuronal. Sin embargo, las
evidencias resultaban indirectas ya que se basaban en ensayos realizados en líneas celulares
(Mukobata et al. 2002) o mediante la utilización de anticuerpos monoclonales anti M6a
como antagonistas de su función en cultivos de neuronas de cerebelo (Lagenaur et al. 1992).
Nuestro objetivo fue entonces investigar la posible función biológica de M6a de forma tal de
entender las consecuencias celulares y fisiológicas de la expresión diferencial de este gen
bajo condiciones de estrés crónico. Para ello, dada su alta expresión en neuronas
hipocampales (Yan et al. 1996; Alfonso et al. 2005), se decidió utilizar cultivos primarios de
neuronas de hipocampo de embriones de rata.
3.1.1 Localización subcelular de la proteína M6a en cultivos primarios de neuronas de
hipocampo
En primer lugar, se determinó la localización subcelular de la proteína M6a endógena
en
cultivos
primarios
de
neuronas
hipocampales.
Se
realizaron
ensayos
de
inmunocitoquímica con un anticuerpo monoclonal contra la proteína M6a que muestran que
la proteína se localiza tanto en la membrana plasmática del soma, así como en los procesos
neuronales (figura 4 A). En estos procesos, la proteína se observa en protrusiones de la
membrana. La tinción de la actina con faloidina confirmó que dichas protrusiones,
enriquecidas en M6a, son estructuras tipo filopodio (figura 4 B).
27
Resultados
Figura 4. Localización de M6a en cultivos primarios de neuronas de hipocampo. A y B. Para determinar la
localización de la proteína M6a endógena, neuronas de 5 días in vitro fueron marcadas por
inmunocitoquímica con anticuerpos monoclonales anti M6a (verde) y con el marcador de F-actina
faloidina (rojo). Una imagen de la célula completa revela la presencia de M6a en la membrana del soma y
en los procesos neuronales (A). La magnificación de un proceso neuronal muestra la presencia de M6a en
protrusiones de la membrana que contienen un citoesqueleto de actina (B). C. Para determinar la
localización de la proteína de fusión, cultivos primarios de neuronas de hipocampo fueron transfectados
con la construcción GFP::M6a. La examinación de los cultivos fijados por microscopía confocal, revela que
la proteína GFP::M6a se localiza en la membrana del soma y de los procesos (a). La examinación en detalle
de un proceso, revela que GFP::M6a se encuentra enriquecida en estructuras tipo filopodios/espinas (b).
La marcación por inmunocitoquímica con anticuerpos anti MAP2 y anti Tau-1 revelan la presencia de
GFP::M6a en dendritas y axones respectivamente (c y d). Barras = 10 m.
A continuación, se determinó la localización de una proteína de fusión compuesta
por GFP y M6a (GFP::M6a), que luego sería utilizada para estudiar la función celular de M6a.
Para ello, se clonó la región codificante (CDS) del gen murino en un vector de expresión
eucariota. El vector utilizado permite la expresión de la proteína de interés como proteína de
fusión a la proteína verde fluorescente (GFP) por lo que es posible visualizar la localización
de la misma. Para determinar si la localización de la proteína de fusión a GFP se corresponde
con la localización de la proteína endógena, se transfectaron cultivos primarios de neuronas
de hipocampo con la construcción GFP::M6a. La figura 4 C muestra que la proteína GFP::M6a
se localiza principalmente en la membrana plasmática del soma y de los procesos (4 C a),
encontrándose enriquecida en estructuras tipo filopodio (4 C b). Por lo tanto, la proteína de
fusión presenta una localización similar a la proteína M6a endógena. Además, se realizaron
ensayos de inmunocitoquímica con anticuerpos anti MAP2 y Tau-1 que son marcadores
28
Resultados
específicos de dendrita y axón, respectivamente. Como se muestra en la figura 4 C, la
proteína de fusión se localiza tanto en dendritas (4 C c) como en axones (4 C d).
El patrón de expresión punteado observado en células que expresan GFP::M6a
(figura 4 C) podría ser indicativo de una concentración de la proteína en estructuras de tipo
pre o post sinápticas. Es por ello que se realizaron ensayos de inmunocitoquímica con
anticuerpos dirigidos contra las proteínas sinaptofisina y espinofilina que son marcadores de
vesículas
pre
y post sinápticas, respectivamente. La figura 5 muestra que M6a sólo
colocaliza con estos marcadores pre y post sinápticos en forma ocasional. Por lo tanto, el
patrón de expresión punteado de M6a no responde a una concentración de la proteína
específicamente en estructuras pre o post sinápticas.
A
GFP::M6a
B
Sinaptofisina
Superposición
Espinofilina
Figura 5. Colocalización entre GFP::M6a y marcadores pre y post sinápticos. Cultivos
primarios de neuronas de hipocampo fueron transfectados con GFP::M6a después de 9-10 días
in vitro. Un día después, las neuronas fueron fijadas y marcadas con anticuerpos contra la
proteína pre sináptica sinaptofisina (A) o post sináptica espinofilina (B). Las flechas verdes y
rojas señalan ejemplos de localización independiente entre M6a y el marcador,
respectivamente. Las flechas amarillas señalan casos de colocalización entre M6a y el
marcador. Barra = 10 m.
3.1.2 La sobreexpresión de M6a induce la formación de neuritas y de filopodios/espinas
Con el fin de determinar la función biológica de M6a, se realizaron ensayos de
sobreexpresión en cultivos primarios de neuronas de hipocampo. Estudios previos sugerían
un rol para M6a en la formación de neuritas (Lagenaur et al. 1992; Mukobata et al. 2002).
Por lo tanto, para determinar si efectivamente M6a está involucrada en la extensión de
neuritas, se transfectaron cultivos primarios de neuronas de hipocampo durante el primer
día de desarrollo in vitro con GFP::M6a o con un plásmido que sólo codifica para la expresión
de GFP utilizado como control. Las células fueron fijadas y las neuritas fueron marcadas por
inmunocitoquímica con anticuerpos anti tubulina, 2 ó 3 días después de la transfección. La
figura 6 A muestra imágenes representativas de una neurona control transfectada con GFP y
29
Resultados
una neurona que sobreexpresa M6a. El número de neuritas por célula fue luego cuantificado
en ambos tipos de células. Como se observa en la figura 6 B, la sobreexpresión de M6a
aumenta significativamente el número de neuritas.
A
B
Neuritas / célula
Tubulina
Número de Neuritas
15
**
10
5
0
Control
Sobreexpresión M6a
Control
M6a
Figura 6. La sobreexpresión de M6a produce un aumento en el número de neuritas.
Cultivos primarios de neuronas de hipocampo de 1 día in vitro fueron transfectados con
GFP::M6a o GFP (control). A los 2 ó 3 días post transfección, las células fueron fijadas y las
neuritas fueron marcadas con anticuerpos anti tubulina (A). El número de neuritas por
célula fue cuantificado (B). El gráfico muestra la media + error estándar de la media (SEM),
de entre 40 y 50 células por grupo provenientes de 3 experimentos independientes.
**p<0,001 calculado con Mann Whitney U-test. Barra = 10 m.
Luego, se evaluó el efecto de la sobreexpresión de M6a en cultivos primarios de
neuronas de hipocampo más avanzados, entre 9 y 10 días in vitro, que corresponde a la
etapa en que las neuronas inician la formación de espinas (Zhang et al. 2001). En esta etapa,
las neuritas de las neuronas muestran un gran número de protrusiones de alta motilidad
llamadas filopodios, así como un creciente número de protrusiones más cortas y estables
llamadas espinas. En estados más avanzados de los cultivos primarios, se observa un
aumento en el número de espinas y una disminución en la cantidad de filopodios. Es por eso
que la teoría actual de la formación de espinas sostiene que éstas se desarrollan a partir de
filopodios (Ziv et al. 1996). Para determinar el efecto de la sobreexpresión de M6a en
cultivos en la etapa de formación de espinas, cultivos primarios de neuronas de hipocampo
fueron transfectados a los 7 días in vitro con GFP::M6a o GFP. A los 2 ó 3 días de la
transfección, se tiñeron las membranas con DiI y se fijaron los cultivos. En la figura 7 A se
muestran imágenes representativas de una neurona que sobreexpresa GFP y una neurona
que sobreexpresa GFP::M6a así como una ampliación de fragmentos de neuritas donde se
observan protrusiones tipo filopodios/espinas. Luego, se cuantificó el número de
protrusiones en fragmentos de 20 m de neurita. En esta etapa in vitro, resulta muy difícil
diferenciar filopodios de espinas basándose en la observación de las protrusiones por
30
Resultados
microscopía de fluorescencia. Es por eso que las protrusiones fueron agrupadas bajo la
categoría de filopodios/espinas. Como se muestra en la figura 7 B, la sobreexpresión de M6a
produce un aumento en la densidad de filopodios/espinas de alrededor de un 100%. Los
resultados muestran la densidad de filopodios/espinas medidos en segmentos de neuritas a
una distancia menor a 50 m del soma. Dentro de esta distancia, la distribución de
filopodios/espinas resultó uniforme ya que no se observaron diferencias entre la densidad
observada en segmentos de neuritas que sobreexpresan M6a a los 0 y a los 30 m del soma
(9,8 ± 2,5 y 9,3 ± 2,8 respectivamente, n = 52, p = 0,49 calculado con Mann Whitney U-test).
Los incrementos observados en el número de procesos y en la densidad de protrusiones en
fragmentos de neuritas en neuronas que sobreexpresan M6a revelan que esta proteína
estaría involucrada en la formación de neuritas y filopodios/espinas.
A
B
Densidad de filopodios/espinas
Protrusiones / 20 μm de neurita
(% control)
250
**
200
150
100
50
0
Control
Sobreexpresión M6a
Control
M6a
Figura 7. La sobreexpresión de M6a aumenta la densidad de filopodios/espinas. Cultivos
primarios de neuronas de hipocampo fueron transfectados a los 7 días in vitro con GFP::M6a o
GFP (control). A los 2 ó 3 días post transfección, las células fueron incubadas con el marcador de
membrana DiI y fijadas (A). El número de protrusiones en fragmentos de 20 m de neurita,
dentro de una distancia menor a 50 m del soma, fue cuantificado (B). El gráfico muestra la
media de número de protrusiones + SEM, expresado como porcentaje del control, de entre 65 y
70 neuritas por grupo provenientes de 3 experimentos independientes. **p<0,001 calculado con
Mann Whitney U-test. Barra = 10 m.
Una vez establecido que la sobreexpresión de M6a producía un aumento en la
densidad de protrusiones de la membrana, se procedió a la caracterización de las mismas.
Para ello, se transfectaron cultivos primarios de neuronas de hipocampo a los 7 días in vitro
con GFP::M6a. A los 2 ó 3 días de la transfección, las células fueron fijadas y distintas
estructuras fueron marcadas por inmuncitoquímica. La marcación de la F-actina con
faloidina muestra que las protrusiones poseen un citoesqueleto de actina (figura 8 A). La
31
Resultados
tinción con MAP2 revela que las protrusiones se originan a partir de dendritas (figura 8 B).
Además, la figura 8 C muestra que las protrusiones poseen acumulaciones de la proteína
post sináptica espinofilina. La tinción de axones con anticuerpos que reconocen la proteína
Tau-1 parece indicar que los axones hacen contacto con las protrusiones de la membrana
inducidas por la sobreexpresión de M6a (figura 8 D). Por último, se observan acumulaciones
de sinaptofisina sobre axones que harían contacto con protrusiones que sobreexpresan M6a
(figuras 8 E y E´). Los sitios de contacto, donde se encuentran acumulaciones de
sinaptofisina, serían sitios de sinapsis, ya que se ha establecido una correlación entre la
formación de sinapsis y acumulaciones de estructuras teñidas con anticuerpos que marcan
vesículas sinápticas, como sinaptofisina (Fletcher et al. 1991). En conjunto, estos resultados
indican que las protrusiones dendríticas inducidas por la sobreexpresión de M6a harían
contacto con axones y participarían en la formación de sinapsis.
GFP::M6a
Superposición
A
B
C
D
E
E´
Figura 8. Caracterización de las protrusiones de membrana inducidas por la sobreexpresión de
M6a. A los 7 días in vitro, cultivos primarios de neuronas de hipocampo fueron transfectados con
GFP::M6a. Las células fueron luego fijadas y marcadas por inmunocitoquímica, 2 ó 3 días después de
la transfección. El citoesqueleto de F-actina fue teñido con faloidina (A) y las dendritas fueron teñidas
con anticuerpos anti MAP2 (B). La tinción con anticuerpos anti espinofilina marca vesículas post
sinápticas (C). Los axones fueron marcados con anticuerpos anti Tau-1 (D). Vesículas pre sinápticas
fueron teñidas con anticuerpos anti sinaptofisina (E). Una ampliación muestra acumulaciones de
sinaptofisina en sitios de aparente contacto con protrusiones que expresan M6a, que serían,
presumiblemente, sitios de sinapsis (E´). Barra = 10 m.
32
Resultados
3.1.3 La reducción en los niveles de M6a produce una disminución en la densidad de
filopodios/espinas y en el número de puntos de sinaptofisina
En base a los resultados anteriores, se decidió comprobar el papel que M6a juega en
la formación de filopodios/espinas por un método alternativo. Para ello, se realizaron
experimentos en los que se redujeron los niveles de expresión de M6a endógena en cultivos
primarios de neuronas de hipocampo mediante la técnica de ARN de interferencia. La
evaluación de los efectos de una reducción en los niveles de expresión de M6a resultaba de
alta relevancia ya que en el hipocampo de animales sometidos a estrés crónico se observa
una disminución en los niveles de expresión de M6a (Alfonso et al. 2004; Alfonso et al.
2006).
En primer lugar, se confirmó que la utilización de pequeños oligonucleótidos de ARN
de interferencia (siRNA, del inglés small interfering ribonucleic acid) resulta en una
disminución en los niveles de expresión de M6a. Para ello, cultivos primarios de neuronas de
hipocampo fueron transfectados con fragmentos de ARN de 21 pb correspondientes a un
fragmento de la secuencia codificante para M6a (M6a siRNA) o con fragmentos de ARN
correspondientes a otra secuencia no relacionada utilizados como control. A los 3 días de la
transfección, el ARNm de los cultivos fue purificado y se cuantificaron los niveles de ARNm
de M6a por ensayos de retrotranscripción (RT) seguidos de PCR en tiempo real. La figura 9 A
muestra que el nivel de ARNm de M6a se encuentra reducido alrededor de un 60% en los
cultivos tratados con el ARN de interferencia específico para M6a. Para determinar si los
niveles de proteína también se encuentran afectados, neuronas de hipocampo fueron
transfectadas con siRNA M6a o con la secuencia control cada 2 ó 3 días de cultivo durante su
desarrollo in vitro. Después de 3 transfecciones, y luego de 9 días in vitro, las células fueron
fijadas y sometidas a ensayos de inmunocitoquímica para la detección de M6a con
anticuerpos monoclonales anti M6a. Como se muestra en la figura 9 B, la
inmunorreactividad en los cultivos interferidos para M6a resultó notablemente menor a la
observada en los cultivos control. Por lo tanto, en cultivos primarios de hipocampo, la
utilización de ARN de interferencia provoca una disminución en los niveles de ARNm y de
proteína M6a.
33
Resultados
A
ARNm M6a
B
Proteína M6a
Control
Nivel ARNm
100
M6a siRNA
80
60
**
40
20
0
Control
M6a siRNA
Figura 9. El tratamiento con ARN de interferencia reduce los niveles de ARNm y proteína M6a. A.
Cultivos primarios de neuronas de hipocampo fueron transfectados con siRNA M6a o con la secuencia
control. A los 3 días post transfección, el ARNm fue purificado y los niveles de ARNm de M6a fueron
determinados por RT-PCR en tiempo real. El gráfico muestra la media + SEM, de los valores de M6a
normalizados con el gen de referencia b-actina, expresados como porcentaje del control, provenientes
de 3 cultivos para cada grupo. **p<0.01, calculado con Mann Whitney U-test. B. Se transfectaron
cultivos primarios de neuronas hipocampales a los 2, 5 y 8 días in vitro con siRNA M6a o con la
secuencia control. A los 9 días in vitro, los cultivos fueron fijados y se realizaron ensayos de
inmunodetección de M6a. La figura muestra imágenes obtenidas por inmunofluorescencia con
anticuerpos monoclonales anti M6a. Barra = 10 m.
La interferencia en la expresión de M6a podría afectar la viabilidad de las células.
Para descartar dicho efecto, se realizaron ensayos de viabilidad por tinción con trypan blue
en cultivos primarios de neuronas de hipocampo tratadas con M6a siRNA o con la secuencia
control. La figura 10 A muestra que el porcentaje de células viables no se encuentra afectado
por el tratamiento de interferencia para M6a. Además, imágenes de contraste de fase
revelan que no existen diferencias morfológicas importantes entre cultivos tratados con M6a
siRNA y con la secuencia control (figura 10 B).
A
% células viables
Viabilidad
B
100
80
60
40
20
0
Control
M6a siRNA
Figura 10. La viabilidad de las neuronas no es afectada por el tratamiento con ARN de interferencia
para M6a. A. Cultivos primarios de neuronas de hipocampo fueron transfectados cada 2 ó 3 días con
M6a siRNA o con la secuencia control. A los 9 ó 10 días in vitro, las células fueron teñidas con trypan
blue y se cuantificó el porcentaje de células viables. El gráfico muestra la media + SEM de 3
experimentos. No se encontraron diferencias significativas entre los tratamientos según Mann Whitney
U-test. B. Imágenes de contraste de fase de cultivos de 9 días in vitro transfectados cada 2 o 3 días con
M6a siRNA o con la secuencia control. Barra = 10 m.
34
Resultados
Una vez determinada la eficiencia de la técnica de ARN de interferencia para reducir
los niveles de expresión de M6a en cultivos primarios de neuronas de hipocampo, se
prosiguió con la evaluación de los efectos de la expresión diferencial de esta proteína.
Cultivos de neuronas de hipocampo fueron transfectados cada 2 ó 3 días in vitro con M6a
siRNA o con la secuencia control. A los 9 ó 10 días in vitro, las membranas de las neuronas
fueron teñidas con DiI y las células fueron fijadas. La figura 11 A muestra imágenes
representativas de procesos neuronales tratados con M6a siRNA y con la secuencia control.
Luego, el número de filopodios/espinas en fragmentos neuríticos de 20 m de extensión fue
cuantificado. La figura 11 B muestra que la interferencia de la expresión de M6a resulta en
una disminución de alrededor de un 40 % en la densidad de filopodios/espinas. En un
segundo experimento, en el que se utilizó otro oligonucleótido de ARN de 21 pb que
reconoce una secuencia de M6a distinta, se obtuvieron resultados similares: la densidad de
filopodios/espinas en los cultivos interferidos para M6a resultó de un 68 ± 7 % en
comparación con el control (n = 70, p < 0,005 calculado con Mann Whitney U-test).
M6a siRNA
B Densidad filopodios/espinas
Protrusiones / 20 m
(% control)
A Control
100
80
**
60
40
20
0
Control
M6a siRNA
Figura 11. La disminución en los niveles de M6a produce una reducción en la densidad de
filopodios/espinas. Neuronas de hipocampo fueron transfectados con M6a siRNA o con la
secuencia control cada 2 ó 3 días de cultivo in vitro. A los 9 ó 10 días in vitro, los cultivos fueron
incubados con DiI para teñir las membranas y fijados (A). Luego, se determinó el número de
filopodios/espinas en 20 m de neurita. El gráfico de la figura B muestra la media de cada
grupo + SEM, expresada como porcentaje de la media del control, de entre 75 y 95 neuritas
por grupo, provenientes de 3 experimentos independientes. ** p<0,001 calculado con Mann
Whitney U-test. Barra = 10 m.
La reducción en la densidad de filopodios/espinas podría traer aparejada una
disminución en el número de sinapsis. Varios estudios han demostrado la capacidad que
poseen los filopodios de participar en la sinaptogénesis (Ziv et al. 1996; Fiala et al. 1998;
Goda et al. 2003). Se decidió, entonces, evaluar los efectos de la expresión reducida de M6a
sobre el número de sinapsis mediante la detección de acumulaciones de sinaptofisina. Como
se mencionó anteriormente, en cultivos primarios de neuronas de hipocampo existe una
35
Resultados
correlación entre el número de sinapsis y las acumulaciones de estructuras teñidas con
anticuerpos que marcan vesículas sinápticas (Fletcher et al. 1991). Por ello, se realizaron
ensayos de inmunodetección con anticuerpos anti sinaptofisina como indicativos del número
de sinapsis. Cultivos primarios de neuronas de hipocampo fueron tratados con M6a siRNA o
con la secuencia control. Los cultivos fueron luego fijados y las acumulaciones de
sinaptofisina fueron marcados por inmunocitoquímica (figura 12 A). El número de puntos de
sinaptofisina en fragmentos de 20 m de neurita fue determinado. Como se muestra en el
gráfico de la figura 12 B, la densidad de puntos de sinaptofisina es significativamente menor
en los cultivos en los que la expresión de M6a fue interferida. Por lo tanto, la reducción de
los niveles de expresión de M6a por ARN de interferencia produce una disminución en la
densidad de filopodios/espinas y puntos de sinaptofisina, que indicarían una disminución en
el número de sinapsis. Estos resultados confirman, por un método alternativo a la
sobreexpresión que M6a, que esta proteína tendría un rol determinante en la formación de
filopodios/espinas en neuronas de hipocampo.
B Densidad de puntos de sinaptofisina
sinaptofisina
Puntos / 20 m de neurita
(% control)
A
Control
M6a siRNA
100
**
80
60
40
20
0
Control
M6a siRNA
Figura 12. La reducción en los niveles de M6a resulta en una menor densidad de puntos de
sinaptofisina. Cultivos primarios de neuronas de hipocampo fueron transfectados cada 2 ó 3 días in vitro
con M6a siRNA o con la secuencia control. Los cultivos fueron fijados a los 9 ó 10 días in vitro, y las
acumulaciones de sinaptofisina fueron marcadas por inmunocitoquímica (A). Se determinó el número de
puntos inmunorreactivos de sinaptofisina en fragmentos de 20 m de neurita. El gráfico de la figura B
muestra la media de cada grupo + SEM, expresada como porcentaje de la media del control, de al menos
55 neuritas por grupo provenientes de 3 experimentos independientes. ** p<0,001 calculado con Mann
Whitney U-test. Barra = 10 m.
3.1.4 Efectos de la sobreexpresión de M6a en líneas neuronales y no neuronales
Para evaluar si la capacidad de M6a de inducir la formación de filopodios se
encuentra restringida a cultivos primarios de neuronas de hipocampo o si se extiende a otros
cultivos celulares, se utilizaron las líneas neuronales neuroblastoma 2a (N2a) y
feocromocitoma 12 (PC12), y la línea no neuronal COS-7. Cultivos de células neuronales N2a
36
Resultados
y PC12 sin diferenciar y cultivos de células no neuronales COS-7, fueron transfectados con
GFP::M6a. Las células fueron fijadas 1 ó 2 días después de la transfección y la actina fue
teñida con faloidina. Como se observa en la figura 13 A, la proteína GFP::M6a se encuentra
enriquecida en estructuras tipo filopodio que poseen un citoesqueleto de actina en los tres
tipos celulares. Una vez diferenciados, los cultivos de N2a y PC12 presentan procesos con un
alto número de filopodios. Sin embargo, en cultivos sin diferenciar se encuentran tanto
células con filopodios como células sin filopodios. Los gráficos de la figura 13 B muestran que
el porcentaje de células N2a y PC12 con filopodios es mayor entre las células transfectadas
con GFP::M6a. Como control se utilizaron células no transfectadas de los mismos
preparados. Estos experimentos demuestran que la sobreexpresión de M6a induce la
formación de filopodios en líneas neuronales.
A
Control
Figura 13. La sobreexpresión
Sobreexpresión M6a
F-actina
F-actina
GFP::M6a
de M6a induce la formación
PC12
de filopodios en células N2a,
PC12 y COS-7. Cultivos de
células neuronales N2a y PC12
sin diferenciar y cultivos de
N2a
células no neuronales COS-7
fueron
transfectados
con
GFP::M6a. Las células fueron
fijadas 1 ó 2 días después de la
COS-7
transfección y la actina fue
teñida con faloidina (A). Los
gráficos
de
la
figura
B
muestran el porcentaje de
N2a
100
**
80
60
40
20
0
Control
M6a
% células con filopodios
% células con filopodios
PC12
COS-7
100
80
**
60
40
20
0
Control
M6a
% células con filopodios
B
células con filopodios. Como
100
80
control se utilizaron células sin
**
60
transfectar
40
del
mismo
preparado. Los resultados se
20
0
Control
M6a
encuentran expresados como
media + SEM de por lo menos
menos 3 preparados de experimentos independientes. ** p<0,001 calculado con la prueba T de Student.
Barra = 10 m.
37
Resultados
De modo similar, en la línea no neuronal COS-7 también se observa un aumento en el
porcentaje de células con filopodios entre las células que sobreexpresan M6a (figura 13 B).
Por lo tanto, M6a es capaz de inducir la formación de filopodios no sólo en cultivos primarios
de neuronas de hipocampo y en cultivos de líneas neuronales sino también en células no
neuronales.
Con el fin de confirmar que la sobreexpresión de la glicoproteína M6a es responsable
de la inducción de la formación de filopodios, se realizaron dos controles. En primer lugar,
células N2a sin diferenciar fueron transfectadas con GFP. Las células fueron luego fijadas y la
actina fue teñida con faloidina. La cuantificación reveló que no existen diferencias en el
porcentaje de células con filopodios entre células transfectadas con GFP (42 ± 5 %) y células
del mismo preparado sin transfectar (40 ± 7 %) utilizadas como control (los resultados se
encuentran expresados como media + SEM de 2 experimentos independientes, p = 0,75
calculado con la prueba T de Student). Estos resultados demuestran que ni la transfección
per se, ni la sobreexpresión de GFP, inducen la formación de filopodios. En un segundo
control, se realizaron experimentos de transfección con una construcción que permite la
expresión de M6a y de GFP de forma independiente (GFP+M6a). De este modo, las células
transfectadas son fácilmente reconocibles ya que expresan GFP, pero la proteína de interés
es expresada sin adición de una proteína reportera. Como se muestra en la figura 14 A, las
células que expresan GFP resultan inmunorreactivas para M6a. Además, la marcación con
anticuerpos monoclones anti M6a revela que la proteína M6a presenta la misma localización
que la proteína GFP::M6a, indicando que la adición de la proteína reportera no afecta a la
localización de la proteína. En las fotos de la figura 14 B se observa que, a diferencia de la
célula no transfectada, la célula que expresa GFP y M6a muestra un gran número de
filopodios al ser teñida con faloidina. Por último, como se muestra en el gráfico de la figura
14 C, el porcentaje de células con filopodios es mayor en las células que sobreexpresan
GFP+M6a que en las células no transfectadas. Por lo tanto, M6a per se es capaz de inducir la
formación de filopodios y esta función, al igual que su localización, no depende de la adición
de la proteína reportera GFP.
38
Resultados
A
GFP
M6a C Células con filopodios
B
GFP
F-actina
% células con filopodios
100
**
80
60
40
20
0
Control
M6a
Figura 14. La sobreexpresión de M6a, independientemente de GFP, posee la misma localización
e induce la formación de filopodios. Cultivos de células N2a sin diferenciar fueron transfectados
con GFP+M6a. Las células fueron fijadas 1 ó 2 días después de la transfección y las células fueron
marcadas por inmunocitoquímica con anticuerpos monoclonales anti M6a (A) o la actina fue
teñida con faloidina (B). Los preparados teñidos con actina fueron utilizados para determinar el
porcentaje de células con filopodios. El gráfico de la figura C muestra los resultados obtenidos.
Como control se utilizaron células sin transfectar del mismo preparado. Los resultados están
expresados como media + SEM de 2 experimentos independientes. ** p<0,01 calculado con la
prueba T de Student. Barra = 10 m.
3.1.5 La localización de M6a no depende de la integridad del citoesqueleto de actina
Ensayos de inmunocitoquímica en cultivos primarios de neuronas de hipocampo han
revelado la acumulación de la proteína M6a endógena en estructuras tipo filopodio ricas en
actina (figura 4 B). Asimismo, en neuronas hipocampales, en líneas neuronales (N2a y PC12)
y líneas no neuronales (COS-7) se observa la misma localización para la proteína GFP::M6a
(figuras 8 A y 13 A). Con el objeto de determinar si la localización de M6a en estructuras tipo
filopodio depende de la integridad del citoesqueleto de actina, se trataron cultivos con
drogas que despolimerizan los mircrofilamentos de actina. Como muestra la tinción con
faloidina en la figura 15 A, el tratamiento de cultivos primarios de neuronas de hipocampo
con latrunculina A resultó en la disrupción del citoesqueleto de actina. Sin embargo, la
inmunodetección de M6a muestra que la proteína aún se localiza en estructuras tipo
filopodio (figura 15 A). De modo similar, el tratamiento de cultivos de N2a con citocalasina D
provocó una desestabilización del citoesqueleto de actina sin alterar la localización de la
proteína GFP::M6a (figura 15 B). Por lo tanto, la localización de M6a en estructuras tipo
filopodio no depende de la integridad del citoesqueleto de actina.
39
Resultados
M6a
F-actina
GFP::M6a
F-actina
Lat A Control
A
Citocalasina D
Control
B
Figura 15. La localización de M6a en estructuras tipo filopodio no depende del citoesqueleto de
actina. A. Cultivos primarios de neuronas de hipocampo de 4 días in vitro fueron tratados con
latrunculina A (Lat A) para desestabilizar el citoesqueleto de actina. Los cultivos fueron luego
fijados y la integridad del citoesqueleto de actina se determinó por tinción de la F-actina con
faloidina (rojo) mientras que la localización de M6a se reveló por inmunocitoquímica con
anticuerpos monoclonales anti M6a (verde). B. Cultivos de células N2a fueron transfectados con
GFP::M6a. Al día siguiente, algunos preparados fueron incubados con el despolimerizante de
actina citocalasina D. Los cultivos luego se fijaron y se tiñeron con faloidina para determinar la
integridad del citoesqueleto de actina (rojo). La localización de GFP::M6a se observa por la
fluorescencia emitida por GFP (verde). Barra = 10 m.
3.1.6 La formación de filopodios inducida por M6a no estaría mediada por proteínas
GTPasas de la familia Rho
La sobreexpresión de M6a resulta en la formación de filopodios tanto en cultivos
primarios de neuronas de hipocampo y en las líneas celulares de fenotipo neuronal N2a y
PC12 como en la línea no neuronal COS-7 (figuras 7 y 13). Por lo tanto, el mecanismo por el
cual M6a induciría la formación de filopodios no sería exclusivo de células neuronales, sino
que se encontraría presente en distintos tipo celulares. En este sentido, las proteínas
GTPasas pequeñas de la familia Rho (Rho, Rac y Cdc42) han sido involucradas en la
regulación del citoesqueleto de actina durante la formación de filopodios en una amplia
variedad de células (Luo 2000; Ridley 2006). Es por ello que decidimos estudiar si la
formación de filopodios inducida por la sobreexpresión de M6a estaría mediada por alguna
de estas GTPasas pequeñas. Para ello, se analizó por Western blot la cantidad de Cdc42, Rac1
40
Resultados
y RhoA activas (unidas a GTP) en cultivos que sobreexpresan M6a en comparación con
cultivos control. Cultivos de células N2a fueron utilizados como control (sin transfectar) o
transfectados con GFP::M6a. A las 24 hs, se purificaron las proteínas Cdc42, Rac1 y RhoA
activas, es decir unidas a GTP, mediante incubación con esferas de agarosas unidas al
dominio PBD de la proteína PAK que sólo une a las formas activas de Cdc42 y Rac1, o unidas
al dominio RBD de la proteína Rhotekina que sólo une RhoA activa. Luego, se realizaron
ensayos de Western blot con anticuerpos específicos para cada GTPasa pequeña para así
determinar la cantidad de proteína activa en las distintas muestras. Como control de carga,
se determinó la cantidad de tubulina en los extractos utilizados para la purificación de las
proteínas GTPasas en estado activo. Como se observa en la figura 16, la cantidad de Cdc42,
Rac1 y RhoA activas no varía entre cultivos control y cultivos que sobreexpresan M6a.
Resultados similares fueron obtenidos en ensayos con células COS-7 (datos no mostrados).
Estos ensayos indicarían que estas GTPasas pequeñas (Cdc42, Rac1 y RhoA) no mediarían los
cambios morfológicos inducidos por la sobreexpresión de M6a.
A
B
Tubulina
Cdc42 activada
Rac1 activada
(Control de carga)
(Control de carga)
+ M6a C
C
Tubulina
+ M6a C
M6a
C
Tubulina
RhoA activada
(Control de carga)
M6a
C
M6a
C
M6a
C
Figura 16. La sobreexpresión de M6a no produce cambios detectables en la cantidad de
Cdc42, Rac1 o RhoA en estado activo. Cultivos de células N2a fueron transfectados con
GFP::M6a (M6a), con Cdc42 constitutivamente activa utilizado como control positivo (+) o no
transfectados y utilizados como control (C). A las 24 hs, los extractos proteicos fueron
incubados con esferas de agarosa con el dominio PBD de la proteína PAK para purificar las
proteínas Cdc42 y Rac1 activas (unidas a GTP) o con el dominio RBD de la proteína Rhotekina
para purificar la proteína RhoA activa. Las fracciones purificadas fueron luego analizadas por
Western blot con anticuerpos anti Cdc42 (A), anti Rac1 (B) o anti RhoA (C). Además, se
determinó con anticuerpos anti -tubulina la cantidad de tubulina en los extractos totales
utilizados para la purificación de las distintas proteínas GTPasas como control de carga.
3.1.7 La palmitoilación y la fosforilación en los loops extracelulares de M6a no serían
necesarias para su función en la formación de filopodios
Como se mencionó anteriormente, según modelos de predicción topográfica basados
en la secuencia aminoacídica de M6a, esta proteína de 278 aminoácidos estaría compuesta
por cuatro dominios transmembrana (TM) separados por tres loops hidrofílicos (dos
41
Resultados
extracelulares y uno intracelular) con los extremos amino y carboxilo terminales en el
citoplasma. Como se muestra en la figura 17, el extremo amino terminal posee un posible
sitio de fosforilación para la proteína quinasa C (PKC) mientras que en el carboxilo terminal
se encuentran dos posibles sitios de fosforilación, uno para la PKC y otro para la proteína
quinasa CK2 (CK2). En el loop extracelular menor se predicen tres sitios de fosforilación para
la CK2, mientras que el loop extracelular mayor posee dos posibles sitios de N-glicosilación y
tres posibles sitos de fosforilación para la CK2. En los loops extracelulares menor y mayor se
encuentran dos y cuatro residuos de cisteína respectivamente, que podrían establecer
puentes disulfuro claves para el correcto plegamiento de la proteína. Además, en las
regiones adyacentes a la cara intracelular de la membrana plasmática se encuentran siete
cisteínas que podrían ser blancos de palmitoilación.
184
174
166
164
60
46
162
T
C
T
C
T
C
T
C
N
T
S
67
T
INTRACELULAR
C 21
NH2
C 18
C 17
10
T
C
14
122
C
N
76
C
193
195
C
44
EXTRACELULAR
192
C 125
202
208
C
246
S
256
COOH
S T
267
268
Figura 17. Estructura propuesta para M6a y aminoácidos que podrían modular su función. El
esquema muestra la estructura de M6a según modelos de predicción topográfica. Se observan los
cuatro dominios transmembrana, los dos loops extracelulares y el loop intracelular, así como los
extremos amino y carboxilo terminal dentro del compartimiento intracelular. Se muestran los
posibles sitios de fosforilación para PKC () y CK2 () y los posibles sitios de N-glicosilación ().
Además, se destacan los residuos de cisteína en los loops extracelulares que estabilizarían la
estructura mediante la formación de puentes disulfuro () y las cisteínas intracelulares que podrían
ser blancos de palmitoilación (). Los números indican la posición aminoacídica de los distintos
residuos.
42
Resultados
La estructura propuesta para M6a se asemeja a la de las proteínas pertenecientes a
la gran familia de las tetraspaninas. M6a comparte con proteínas de esta familia el motivo
Tyr-Xaa-Xaa-ø (donde ø representa un aminoácido con residuo hidrofóbico) en el extremo
carboxilo terminal y la presencia de siete cisteínas en regiones yuxtapuestas a la membrana
que podrían ser palmitoiladas (Stipp et al. 2003). Para varios miembros de la gran familia de
las tetraspaninas (CD9, CD81, CD82 y Cd151) la palmitoilación ha resultado ser clave para su
localización e interacción con otras proteínas. Además, mutaciones en los sitios de
palmitoilación en distintas tetraspaninas han sido asociadas a alteraciones en la morfología
celular (Hemler 2005; Schneider et al. 2005). Es por ello, que se decidió realizar un estudio
mutacional, en el cual se mutaron los siete residuos de cisteína que podrían ser blanco de
palmitoilación, para luego evaluar la funcionalidad de la proteína resultante en la formación
de filopodios. Por otra parte, la fosforilación mediada por CK2 en residuos extracelulares de
proteínas de membrana ha sido involucrada en la regulación de la morfología celular y el
citoesqueleto de actina (Canton et al. 2006). Por este motivo, se estudió la capacidad de
distintas mutantes de la proteína M6a, donde se sustituyeron los aminoácidos extracelulares
clave para la fosforilación por CK2, de inducir la formación de filopodios.
Las distintas mutantes de M6a, fueron obtenidas mediante la técnica de mutagénesis
dirigida. De este modo se realizó una séptuple mutante en los posibles sitios de
palmitoilación en la cual los siete residuos de cisteína de presunta localización intracelular
fueron sustituidos por residuos de serina (M6a C14S C17S C18S C21S C122S C125S C246S).
Por otra parte, se construyeron simples y múltiples mutantes en los sitios extracelulares de
fosforilación intercambiando los residuos de treonina y serina por alaninas (M6a T60A, M6a
T67A, M6a T76A, M6a T60A T67A T76A, M6a T166A, M6a T184A, M6a T193A S195A y M6a
T166A T184 T193A S195A). Una vez obtenidas las distintas mutantes, se transfectaron
células N2a y cultivos primarios de neuronas de hipocampo. En ningún caso se observó un
cambio en la localización subcelular de la proteína. Se procedió entonces a evaluar la
capacidad de las distintas proteínas de promover la formación de filopodios. Como se
observa en las figuras 18 A y B la séptuple mutante en los posibles sitios de palmitoilación así
como las distintas mutantes en los sitios extracelulares de fosforilación poseen la misma
capacidad que M6a wild type para inducir la formación de filopodios tanto en la línea celular
N2a como en cultivos primarios de neuronas de hipocampo. Por lo tanto, la palmitoilación y
la fosforilación extracelular de M6a no mediarían los efectos en la formación de filopodios.
43
Resultados
Células N2a con filopodios
% células con filopodios
A
100
**
**
**
**
**
M6a
Palm
M6a
T60A
M6a
T67A
M6a
T76A
M6a
CK2
EC1
**
80
**
**
**
**
M6a
T166A
M6a
T184A
M6a
T193A
S195A
M6a
CK2
EC2
60
40
20
0
GFP
M6a
Densidad de filopodios en neuronas de hipocampo
Protrusiones / 20 m
(% control)
B
200
**
**
**
**
M6a
M6a
Palm
M6a
CK2
EC1
M6a
CK2
EC2
150
100
50
0
Control
Figura 18. Inducción de la formación de filopodios por mutantes de M6a en los posibles sitios de
palmitoilación y fosforilación extracelular. A. Células N2a fueron transfectadas con GFP, M6a wild type o
las distintas mutantes de M6a. Al día siguiente, las células fueron fijadas y la actina fue teñida con
faloidina. El gráfico muestra el porcentaje de células con filopodios. Como control se utilizaron células sin
transfectar del mismo preparado. Las barras blancas representan las células transfectadas con las
construcciones que se indican debajo de las mismas mientras que las barras negras representan las
células control sin transfectar provenientes de los mismos preparados. Los resultados están expresados
como media + SEM de al menos 7 preparados de 2 experimentos independientes. ** p<0,001 calculado
con la prueba T de Student. B. Cultivos primarios de neuronas de hipocampo fueron transfectados a los 3
días in vitro con GFP, M6a wild type o distintas mutantes de M6a. Al día siguiente, los cultivos fueron
fijados y el número de protrusiones en fragmentos de 20 m de neurita fue cuantificado. El gráfico
muestra la media + SEM, expresado como porcentaje del control (GFP), de por lo menos 60 neuritas por
grupo. **p<0,01 versus GFP calculado por ANOVA de un factor seguido por la prueba de Dunnet para
efectos post hoc. No se encontraron diferencias significativas entre M6a wild type y las distintas mutantes
de M6a. El gráfico muestra los resultados de un experimento, representativo de 3 experimentos
independientes. M6a Palm: M6a C14S C17S C18S C21S C122S C125S C246S, M6a CK2 EC1: M6a T60A
T67A T76A, M6a CK2 EC2: M6a T166A T184 T193A S195A.
44
Resultados
3.2 LA FAMILIA DE LAS PROTEÍNAS PROTEOLIPÍDICAS: REGULACIÓN POR EL ESTRÉS
CRÓNICO Y ROL EN LA FORMACIÓN DE FILOPODIOS
La proteína M6a, cuya expresión en el hipocampo se encuentra modulada por la
exposición a tratamientos de estrés crónico y la administración de drogas antidepresivas,
pertenece a la familia de las proteínas proteolipídicas (PLPs). En mamíferos, esta familia está
compuesta por M6a, M6b y PLP/DM20. Como se mencionó anteriormente, estas proteínas
muestran una alta homología entre sí compartiendo, además, una estructura similar. Dada la
similitud encontrada entre los distintos miembros que conforman la familia PLP, se decidió
estudiar si la expresión de los otros miembros de la familia también se encuentra alterada en
el hipocampo de animales estresados crónicamente. Asimismo, teniendo en cuenta el rol
descripto para M6a en la formación de filopodios (figuras 7 y 13), se decidió investigar si esta
capacidad se encuentra conservada en otros miembros de la familia PLP.
3.2.1 Homología entre los miembros de la familia de las PLPs
En los mamíferos, la familia de las PLPs está constituida por M6a, M6b y PLP/DM20
(Yan et al. 1993). De acuerdo con modelos de predicción estructural, estas proteínas
comparten la estructura descripta en la figura 3 compuesta por cuatro dominios
transmembrana (TM) separados por tres loops hidrofílicos, con los extremos amino y
carboxilo terminales en el citoplasma. (Popot et al. 1991; Yan et al. 1993). En la figura 19 se
muestra la identidad aminoacídica entre M6a, M6b, PLP y DM20 en la región comprendida
por los cuatro dominios TM, los loops extracelulares menor y mayor, y el loop intracelular.
PLP y DM20 son distintas isoformas codificadas por un mismo gen que se generan por el
splicing alternativo del exón 3b. Al analizar la región completa, M6a muestra mayor
identidad con M6b que con DM20. Al poseer un dominio extra de 35 aminoácidos codificado
por el exón 3b, PLP presenta menor identidad con M6a. Al analizar cada región por
separado, se encuentran similitudes dispares. La identidad aminoacídica más elevada se
observa en el primer dominio TM, con valores de 82% para M6b y 67% para PLP y DM20 con
respecto a M6a. Mientras que en el loop intracelular y el segundo dominio TM estas
proteínas aún comparten una alta identidad (con valores entre el 55 % y el 65 %), no se
encuentran similitudes significativas en el loop extracelular menor y en el cuarto dominio
TM. En el tercer dominio TM, solo se encuentra similitud entre M6a y M6b, mientras que en
el loop extracelular mayor, sólo PLP y DM20 muestran similitud con M6a.
45
Resultados
EC 1
M6a
TM 1
M6b
TM 1
IC
EC 1
82 %
SNS
TM 1
67 %
SNS
61 %
EC 2
TM 3
65 %
65 %
IC
TM 2
SNS
65 %
SNS
EC 2
TM 3
55 %
(46 %)
TM 4
32 %
SNS
3b
SNS
EC 2
TM 3
55 %
(51 %)
TM 4
SNS
48 %
IC
EC 1
67 %
TM 4
IC
TM 2
TM 1
PLP
TM 3
TM 2
EC 1
DM20
EC 2
TM 2
SNS
TM 4
32 %
(38 %)
SNS
Figura 19. Identidad aminoacídica entre miembros de la familia de las PLPs. Esquemas que muestran
la identidad aminoacídica en los dominios tansmembrana (TM), el loop extracelular menor (EC 1), el
loop intracelular (IC) y el loop extracelular mayor (EC 2) de M6b, DM20 y PLP, relativa a M6a. La
identidad relativa en cada dominio se muestra debajo de cada diagrama. La identidad en toda la región
se muestra entre paréntesis. 3b: región codificada por el exón alternativo 3b. SNS: similitud no
significativa.
3.2.2 Efectos del estrés crónico sobre la expresión de los miembros de la familia de las
PLPs
Con el objeto de evaluar el efecto del estrés sobre la expresión de genes de la familia
de las PLPs en el hipocampo, se utilizó el modelo de estrés crónico por confinamiento en
ratones. Se realizaron ensayos de inmovilización de 4 horas por día, durante 21 días, con
ratones machos de la cepa C57BL/6. Durante la duración del experimento, los animales
estresados mostraron un menor aumento de peso que los animales control (control = 108,44
± 2,64; estresados = 95,84 ± 1,70, los datos indican la media ± SEM de 9 animales por grupo
expresada como porcentaje del peso inicial, p < 0,01 calculado con la prueba T de Student).
Estos resultados indican que el grupo de animales sujeto a inmovilización resultó realmente
afectado y concuerdan con lo reportado anteriormente para animales estresados con el
mismo modelo de inmovilización (Magarinos et al. 1995).
Una vez terminado el tratamiento de estrés se obtuvieron muestras de ARNm de los
hipocampos de los ratones estresados y control. La cuantificación de los niveles de expresión
de los genes de interés se realizó por la técnica de RT-PCR en tiempo real. En concordancia
con experimentos anteriores, el nivel de expresión de M6a se encontró reducido en el
46
Resultados
hipocampo de los animales estresados (figura 20 A). Como se muestra en la figura 20 B, los
animales sometidos a estrés crónico también mostraron una reducción en los niveles de
expresión de M6b en comparación con los animales control. Como se mencionó en la
introducción, y se detalla en la próxima sección, se han identificado varias isoformas de M6b
(Werner et al. 2001). En la determinación de los niveles de expresión de M6b por PCR en
tiempo real (figura 20 B), se utilizaron oligonucleótidos en el extremo 3´UTR (del inglés,
untranslated region) que amplifican todas las isoformas de M6b descriptas (figura 21). Por lo
tanto, la expresión del total de las isoformas de M6b se encuentra reducida en el hipocampo
de animales estresados crónicamente.
A
B
M6a
40
40
20
0
0
Estrés
Expresión relativa
**
60
20
Control
E
40
Control
F
DM20
40
0
0
PLP
DM20
*
60
20
Estrés
PLP
100
80
20
40
0
nivel ARNm
nivel ARNm
60
60
Estrés
100
80
80
20
Control
100
nivel ARNm
80
nivel ARNm
**
60
nivel ARNm
nivel ARNm
80
PLP / DM20
100
100
100
D
C
M6b
80
60
40
20
0
Control
Estrés
Control
Estrés
Figura 20. Efectos del estrés crónico sobre la expresión de genes de la familia de las PLPs en el
hipocampo. Ratones macho de la cepa C57BL/6 fueron crónicamente estresados (barras blancas) o
utilizados como control (barras negras). Muestras de ARNm de los hipocampos de los animales
fueron cuantificadas por RT-PCR en tiempo real. Los gráficos muestran los niveles de expresión de
M6a (A), M6b (B), PLP/DM20 (C), DM20 (E) and PLP (F). Los niveles de expresión para cada individuo
fueron normalizados con el gen de referencia ciclofilina. Los resultados están expresados como la
media de cada grupo + SEM proveniente de 9 animales por grupo y como porcentaje del grupo
control. *p<0,05 y **p<0,01 calculado por la prueba T de Student. Para cuantificar la expresión
relativa entre PLP y DM20 (D) se utilizó un oligonucleótido antisentido en común junto a
oligonucleótidos sentido específicos para los ARNm de PLP y DM20. Los resultados están expresados
como la media para cada isoforma + SEM de 9 animales control y como porcentaje de PLP.
47
Resultados
En el caso de PLP y DM20, sus niveles de expresión fueron medidos, en un primer
momento, con oligonucleótidos que amplificaban una región del extremo 3´UTR compartida
por ambas moléculas de ARNm, no habiéndose encontrado diferencias significativas entre
los animales estresados crónicamente y los animales control (figura 20 C). Al cuantificar la
expresión relativa de cada transcripto, se encontró que PLP se expresa alrededor de diez
veces más que DM20 en el hipocampo de ratones adultos no estresados (figure 20 D).
Entonces, se decidió determinar los niveles de expresión para cada isoforma en el
hipocampo de animales control y estresados. Como se muestra en la figura 20 E, la expresión
de DM20 se encontró disminuida en los animales estresados. Por el contrario, la expresión
de PLP no se vio afectada en forma significativa por el tratamiento de estrés (figura 20 F).
Por lo tanto, el estrés crónico disminuye la expresión de M6b y DM20 en el hipocampo
mientras que la expresión de PLP no se encontraría alterada.
3.2.3 Isoformas de M6b
Varias isoformas han sido descriptas para la proteína M6b (Werner et al. 2001). Las
distintas isoformas de M6b son el resultado de la utilización de promotores alternativos para
el inicio de la transcripción en combinación con eventos alternativos de splicing (figura 21).
La presencia del dominio en el extremo amino de la proteína (representado en color
naranja en la figura 21 y presente en las isoformas M6b TMD, M6b TMD, M6b
TMD, M6b TMD, M6b y M6b ) se encuentra determinada por el sitio de inicio
de la transcripción utilizado. En tanto, el splicing alternativo es responsable de la presencia
del dominio en la región amino terminal de la proteína codificado por el exón II
(representado en color amarillo en la figura 21 y presente en las isoformas M6b TMD,
M6b TMD y M6b ), y de la inclusión del dominio (en M6b TMD, M6b TMD y
M6b TMD) o el dominio (en M6b TMD, M6b TMD, M6b TMD) en el extremo
carboxilo de la proteína (representados en color violeta y fucsia, respectivamente, en la
figura 21). La inclusión del exón alternativo III genera ARNms que codifican para proteínas
más cortas (M6b y M6b ), sin los dominios TM y con el dominio en el extremo
carboxilo terminal (representado en azul en la figura 21).
48
Resultados
TMD
Ia
IV
V
VI
VII VIII
X
IV
V
VI
VII VIII
X
IV
V
VI
VII VIII
X
IV
V
VI
VII VIII
IX
X
IV
V
VI
VII VIII
IX
X
IV
V
VI
VII VIII
IX
X
III
IV
V
VI
VII VIII
IX
X
III
IV
V
VI
VII VIII
IX
X
TMD
Ib
TMD
Ib
II
TMD
Ia
TMD
Ib
TMD
Ib
II
Ib
Ib
II
Figura 21. Estructura de los ARNm de M6b y sus productos proteicos. El gen de M6b da origen a distintos
ARNm que codifican para 8 isoformas proteicas. Los exones se encuentran representados por rectángulos
y los intrones por líneas. En colores se resaltadas las regiones codificantes. Los números romanos indican
el número de exón y a la derecha de cada esquema se incluye el nombre asignado a la isoforma proteica
codificada por cada ARNm. Los distintos ARNm son el resultado del uso alternativo de sitios de inicio de la
transcripción (exones Ia y Ib) y eventos de splicing alternativo. Los exones IV-VIII codifican para los
dominios transmembrana. Las flechas azules muestran la posición de los oligonucleótidos utilizados para
determinar los niveles de expresión total de M6b por PCR en tiempo real en animales estresados y
control. Las flechas rojas indican la posición de los oligonucleótidos utilizados para determinar la
expresión relativa de distintas isoformas de M6b. Las flechas verdes representan la ubicación de los
oligonucleótidos utilizados para amplificar las secuencias codificantes (CDS) de las distintas isoformas.
Adaptado de Werner et al., 2001.
Para estudiar la contribución relativa de las distintas isoformas de M6b al nivel total
de expresión de M6b, se determinaron los niveles de expresión de distintas isoformas en el
hipocampo de animales no estresados. Se utilizaron oligonucleótidos específicos para la
amplificación de los exón Ia (presente en los transcriptos que codifican para las isoformas
M6b TMD y M6b TMD) y el exón Ib (presente en los ARNms que codifican para las
isoformas M6b TMD, M6b TMD, M6b TMD, M6b TMD, M6b y M6b ),
que representan sitios alternativos del inicio de la transcripción; así como oligonucleótidos
49
Resultados
específicos para la amplificación del exón III, que sólo se encuentra presente en los ARNm
que codifican para las proteínas más cortas sin los dominios TM (M6b y M6b ). Como
se muestra en la figura 22, se encontraron niveles similares de moléculas de ARNm con el
exón Ia y el exón Ib, lo que podría ser indicativo de un uso similar de los promotores
alternativos en el hipocampo. Por el contrario, el nivel de expresión de isoformas con el exón
III resultó 8 órdenes de magnitud menor (figura 22), indicando que las isoformas de M6b sin
los dominios TM (M6b y M6b ) no se expresan significativamente en el hipocampo.
Expresión relativa de isoformas de M6b
nivel ARNm
nivel ARNm
100
100
50
0,000001
0
M6b TMD M6b TMD M6b III
M6b Ia
TMD M6b IB
TMD M6b
M6b TMD
M6b TMD
M6b M6b exón Ia
exón Ib
exón III
Isoformas
Primers
Figura 22. Niveles de expresión relativa de isoformas de M6b en el
hipocampo. Muestras de ARNm de hipocampo de ratón adulto fueron
cuantificadas por RT-PCR en tiempo real utilizando oligonucleótidos que
amplifican los exones Ia, Ib y III de M6b. Los resultados están expresados
como la media de cada grupo + SEM proveniente de 3 animales control y
como porcentaje del exón Ib. La figura muestra todas las isoformas
descriptas en la literatura cuyos ARNm contienen los distintos exones
(Werner et al. 2001).
3.2.4 Clonado y expresión de isoformas de M6b y PLP
En las secciones anteriores se mostró que un miembro de la familia de las PLPs, la
glicoproteína M6a, promueve la formación de neuritas y filopodios/espinas en cultivos
primarios de neuronas de hipocampo y en diversas líneas celulares (figuras 7 y 13). Por lo
tanto, se decidió evaluar la capacidad de los otros miembros de la familia PLP de inducir la
50
Resultados
formación de filopodios. Para ello, se procedió con el clonado de las distintas isoformas de
M6b y PLP. En el caso de M6b, de las ocho isoformas descriptas en la literatura (Werner et
al. 2001), representadas en la figura 21, sólo cinco pudieron ser clonadas por RT-PCR a partir
de ARNm de hipocampo de ratón adulto: M6b TMD, M6b TMD, M6b TMD, M6b
TMD y M6b . Moléculas de ARNm conteniendo el exón alternativo II, que codifica para
el dominio en la región citosólica N terminal de la proteína, no han podido ser
amplificadas, posiblemente debido a una baja expresión en el hipocampo de ratón adulto.
También se clonaron por RT-PCR las secuencias codificantes para PLP y DM20. Las
secuencias codificantes para las distintas isoformas de M6b, PLP y DM20 fueron clonadas
como proteínas de fusión a GFP, para poder visualizar su localización y analizar su función.
Cultivos primarios de neuronas de hipocampo y células N2a fueron transfectados con las
distintas construcciones (figura 23). Como ha sido descripto para la proteína endógena
(Werner et al. 2001), GFP::M6b TMD se observa en estructuras intracelulares y en la
superficie de las neuronas (figura 23 a y b). Como se muestra en la figura 23 c, imágenes de
células N2a transfectadas obtenidas por microscopía confocal sugieren una localización en la
membrana plasmática para la proteína de fusión GFP::M6b TMD. Las proteínas GFP::M6b
TMD, GFP::M6b TMD y GFP::M6b TMD presentan la misma localización que
GFP::M6b TMD (figura 23 d-l). La isoforma que no posee los sitios transmembrana,
GFP::M6b , se localiza en el citoplasma (figura 23 m-o). Las proteínas GFP::PLP y
GFP::DM20 también presentan una localización que concuerda con lo descripto para las
proteínas endógenas (Thomson et al. 1997). Ambas proteínas presentan una localización
similar que incluye tanto la presencia en estructuras intracelulares como una marcada
expresión en la superficie celular, muy probablemente, la membrana plasmática. (figuras 23
p-u). Por último, la proteína VSVG (del inglés, G protein of Vesicular Stomatitis Virus) ha sido
utilizada como proteína control de localización en la membrana plasmática (figura 22 v-x).
51
Resultados
Figura 23. Localización celular de las isoformas de M6b y PLP. Los esquemas en la parte izquierda de
la figura muestran una representación de las secuencias codificantes (CDS) que se clonaron como
proteínas de fusión a GFP. Cultivos primarios de neuronas de hipocampo y células N2a fueron
transfectados con las distintas construcciones. Imágenes obtenidas por microscopía confocal
muestran la localización de las proteínas de fusión en neuronas (a, d, g, j, m, p, s, v; magnificaciones
b, e, h, k, n, q, t y w) y en células N2a (c, f, i, l, o, r, u y x). VSVG: proteína de membrana utilizada como
control. TMD: dominios transmembrana. 3b: exón alternativo presente en PLP y no en DM20. Barra =
10 m.
52
Resultados
3.2.5 M6b y DM20 inducen la formación de filopodios en cultivos primarios de neuronas
de hipocampo y en líneas celulares
Con el fin de evaluar la capacidad de M6b de promover la formación de filopodios, se
decidió realizar ensayos de sobreexpresión con las distintas isoformas de M6b. Cultivos
primarios de neuronas de hipocampo fueron transfectados a los 7 días in vitro con GFP
(control), GFP::M6a o las construcciones de GFP fusionadas a las distintas isoformas de M6b
que contienen los dominios TM. Un día después de la transfección, las neuronas fueron
fijadas y la actina fue teñida con faloidina (figura 24 A). Luego, se determinó el número de
protrusiones en fragmentos de 20 m de neurita. Como se muestra en la superposición de la
figura 24 A, las protrusiones poseen un citoesqueleto de actina, característico de los
filopodios. El gráfico de la figura 24 B muestra que las distintas isoformas de membrana de
M6b inducen la formación de filopodios en forma similar a M6a.
Figura 24. La sobreexpresión de isoformas
A
F-actina
Superposición
GFP
de membrana de M6b aumenta la densidad
de
filopodios.
neuronas
GFP::M6a
Cultivos
de
primarios
hipocampo
de
fueron
transfectados a los 7 días in vitro con GFP,
GFP::M6a,
GFP::M6b
TMD,
GFP::M6b
GFP::M6b TMD
TMD, GFP::M6b TMD y GFP::M6b
TMD. Un día después, las neuronas
GFP::M6b TMD
fueron fijadas y la actina fue teñida con
faloidina (A). El número de protrusiones en
GFP::M6b TMD
20 m de neurita fue cuantificado (B). El
gráfico muestra la media + SEM, expresada
GFP::M6b TMD
como porcentaje del control (GFP), de por lo
menos 80 neuritas por grupo. **p<0,01
versus GFP calculado por ANOVA de un
Protrusiones / 20 μm
(% control)
B
Densidad de filopofios
**
**
**
200
factor seguido por la prueba de Dunnet para
**
**
150
efectos post hoc. No se encontraron
100
diferencias significativas entre M6a y las
50
distintas
isoformas de M6b. El gráfico
0
Control
M6a
M6b
TMD
M6b
TMD
M6b
M6b
TMD TMD
muestra los resultados de un ensayo,
representativo
de
2
experimentos
independientes. Barra = 10 m.
53
Resultados
Luego, se analizó si PLP y DM20 eran capaces de modificar la densidad de filopodios
en neuronas hipocampales, con un diseño experimental similar al anterior. Cultivos
primarios de neuronas de hipocampo de 3 días in vitro fueron transfectados con GFP,
GFP::M6b , VSVG::GFP, GFP::M6a, GFP::PLP o GFP::DM20. Al día siguiente, las células
fueron fijadas y la actina fue teñida con faloidina (figura 25 A). La cuantificación del número
de protrusiones en 20 m de neurita reveló que la sobreexpresión de DM20 induce la
formación de filopodios, aunque en menor medida que la sobreexpresión de M6a (figura 25
B). Por el contrario, la sobreexpresión de PLP no produjo un aumento en la densidad de
filopodios. Para evaluar la importancia de la localización en la membrana y/o de los dominios
TM, se utilizó la construcción que codifica para la expresión de la isoforma M6b que no
posee los dominios TM. La sobreexpresión de GFP::M6b no produjo un aumento en la
densidad de filopodios, sugiriendo que la localización de M6b en la membrana plasmática
y/o la presencia de los dominios TM es crucial para su función en la formación de filopodios.
Para comprobar que la sobreexpresión de cualquier proteína de membrana no es suficiente
para promover el crecimiento de filopodios, se utilizó la proteína VSVG. La sobreexpresión
de VSVG::GFP no resultó en un aumento en la densidad de filopodios demostrando que el
efecto es específico de las proteínas M6a, M6b y DM20.
A
F-actina
Superposición
GFP
Figura 25. La sobreexpresión de DM20, pero
no de PLP, induce la formación de
filopodios. Después de 3 días in vitro,
GFP::M6b neuronas
VSVG::GFP
de
hipocampo
transfectadas
con
GFP,
VSVG::GFP,
GFP::M6a,
fueron
GFP::M6b
,
GFP::PLP
o
GFP::DM20. Al día siguiente, las neuronas
fueron fijadas y la actina fue teñida con
GFP::M6a
faloidina (A). El número de protrusiones en
20 m de neurita fue cuantificado (B). El
GFP::PLP
gráfico muestra la media + SEM, expresado
como porcentaje del control (GFP), de por lo
GFP::DM20
menos 80 neuritas por grupo. **p<0,01
versus GFP, #p<0,01 versus M6a, calculado
B
por ANOVA de un factor seguido por la
Protrusiones / 20 μm
(% control)
Densidad de filopofios
200
**
prueba de Dunnet para efectos post hoc. Se
#
**
150
muestran los resultados de un ensayo,
representativo
100
de
3
experimentos
independientes. Barra = 10 m.
50
Control
M6b VSVG
M6a
PLP
DM20
54
Resultados
Para estudiar la capacidad de M6b y DM20 de inducir la formación de filopodios en
otras sistemas celulares, se realizaron ensayos de sobreexpresión en la línea neuronal N2a y
la línea no neuronal COS-7 (figuras 26 y 27, respectivamente). Ambos cultivos fueron
transfectados con las mismas construcciones utilizadas en cultivos primarios de neuronas de
hipocampo. Las células fueron fijadas 1 ó 2 días después de la transfección y la actina fue
marcada con faloidina para permitir la visualización de los filopodios (figuras 26 A y 27 A).
Como se muestra en los gráficos de las figuras 26 B y 27 B, la sobreexpresión de GFP no
resulta en un aumento en el porcentaje de células con filopodios en la línea neuronal N2a ni
en la línea no neuronal COS-7. Por el contrario, la sobreexpresión de M6a, de las isoformas
de M6b que poseen dominios TM y de DM20, produjo un aumento en el porcentaje de
células con filopodios. En ambas líneas celulares, las isoformas de membrana de M6b fueron
capaces de inducir la formación de filopodios de un modo similar a M6a. En concordancia
con lo hallado en cultivos primarios de neuronas de hipocampo, DM20 sólo indujo
levemente la formación de filopodios en N2a en comparación con M6a (figura 26 B). Sin
embargo, en células no neuronales COS-7, DM20 indujo la formación de filopodios
notablemente, con valores similares a los obtenidos para M6a (figura 27 B). Por lo tanto, al
igual que sucede para M6a, la capacidad de las isoformas de membrana de M6b y DM20 de
inducir la formación de filopodios no se encuentra restringida a cultivos primarios de
neuronas de hipocampo y cultivos de líneas neuronales (N2a) sino que también se observa
en cultivos de células no neuronales (COS-7).
De forma similar a lo realizado con la proteína M6a se construyeron vectores de
expresión que codifican para la expresión de las distintas isoformas de membrana de M6b
de forma separada de GFP (GFP+M6b TMD, GFP+M6b TMD, GFP+M6b TMD y
GFP+M6b TMD). Así, las células transfectadas expresan GFP y son fácilmente
reconocibles, pero la proteína de interés es expresada sin adición de la proteína reportera, lo
que podría alterar su función. Se realizaron ensayos de sobreexpresión en N2a con estas
construcciones. Como se muestra en el gráfico de la figura 28, el porcentaje de células con
filopodios es mayor en las células que sobreexpresan las distintas isoformas de M6b de
forma independiente de GFP que en células sin transfectar. Por lo tanto, las distintas
isoformas de membrana M6b son capaces de inducir la formación de filopodios por sí
mismas, no estando la proteína reportera GFP involucrada en esta función.
55
Resultados
A
Cél. no transfectada F-actina
GFP
F-actina
GFP::M6a
F-actina
GFP::M6b TMD
F-actina
GFP::M6b TMD
F-actina
GFP::M6b TMD
F-actina
GFP::M6b TMD
F-actina
GFP::DM20
F-actina
B
% cél. con filopodios
Células N2a con filopodios
100
**
80
**
*
**
**
60
#
**
40
20
0
GFP
M6a
M6b
TMD
M6b
TMD
M6b
TMD
M6b
TMD
DM20
Figura 26. Inducción de la formación de filopodios por M6b y DM20 en células N2a. Cultivos de células
neuronales N2a sin diferenciar fueron transfectados con GFP (control negativo), GFP::M6a (control
positivo), GFP::M6b TMD, GFP::M6b TMD, GFP::M6b TMD, GFP::M6b TMD o GFP::DM20. Las
células fueron fijadas 1 ó 2 días después de la transfección y la actina fue teñida con faloidina (A). Los
gráficos de la figura B muestran el porcentaje de células con filopodios. Como control se utilizaron células
sin transfectar del mismo preparado. Las barras blancas representan las células transfectadas con las
construcciones que se indican debajo de las mismas mientras que las barras negras representan las
células control sin transfectar provenientes de los mismos preparados. Los resultados están expresados
como media + SEM de un mínimo de 6 preparados de al menos 2 experimentos independientes. *p<0,05
y ** p<0,01 calculados con la prueba T de Student comparando las células transfectadas y sin transfectar
dentro de cada grupo. #p<0,01 calculado con la prueba T de Student versus incremento en M6a. Barra =
10 m.
56
Resultados
A
Cél. no transfectada F-actina
GFP
F-actina
GFP::M6a
F-actina
GFP::M6b TMD
F-actina
GFP::M6b TMD
F-actina
GFP::M6b TMD
F-actina
GFP::M6b TMD
F-actina
GFP::DM20
F-actina
B
% cél. con filopodios
Células COS-7 con filopodios
100
**
**
**
**
M6b
TMD
M6b
TMD
M6b
TMD
80
**
**
60
40
20
0
GFP
M6a
M6b
TMD
DM20
Figura 27. La sobreexpresión de M6b y DM20 induce la formación de filopodios en células COS-7.
Cultivos de células COS-7 fueron transfectados con GFP (control negativo), GFP::M6a (control positivo),
GFP::M6b TMD, GFP::M6b TMD, GFP::M6b TMD, GFP::M6b TMD o GFP::DM20. Las células
fueron fijadas 1 ó 2 días después de la transfección y la actina fue teñida con faloidina (A). Los gráficos de
la figura B muestran el porcentaje de células con filopodios. Como control se utilizaron células sin
transfectar del mismo preparado. Las barras blancas representan las células transfectadas con las
construcciones que se indican debajo de las mismas mientras que las barras negras representan las
células control sin transfectar provenientes de los mismos preparados. Los resultados están expresados
como media + SEM de un mínimo de 6 preparados de al menos 2 experimentos independientes. **p<0,01
calculado con la prueba T de Student. Barra = 10 m.
57
Resultados
% cél. con filopodios
Células N2a con filopodios
100
**
80
**
**
**
M6b
TMD
M6b
TMD
M6b
TMD
**
60
40
20
0
GFP
M6a
M6b
TMD
Figura 28. La sobreexpresión de M6b, independientemente de GFP, induce la formación de
filopodios. Cultivos de células N2a sin diferenciar fueron transfectados con GFP (control negativo),
GFP::M6a (control positivo), GFP+M6b TMD, GFP+M6b TMD, GFP+M6b TMD o GFP+M6b
TMD. Las células fueron fijadas 1 ó 2 días después de la transfección y la actina fue teñida con
faloidina para permitir la visualización de los filopodios. El gráfico muestra el porcentaje de células
con filopodios. Como control se utilizaron células sin transfectar del mismo preparado. Las barras
blancas representan las células transfectadas con las construcciones que se indican debajo de las
mismas mientras que las barras negras representan las células control provenientes de los mismos
preparados. Los resultados están expresados como media + SEM de un mínimo de 6 preparados de
al menos 2 experimentos independientes. **p<0,01 calculado con la prueba T de Student.
En conjunto, los resultados de esta sección indican que las isoformas de membrana
de M6b y DM20 comparten con M6a la capacidad de inducir la formación de filopodios. Por
el contrario, la proteína PLP, que constituye el único miembro de la familia de las PLPs cuya
expresión no se encontró alterada por la exposición a estrés crónico, tampoco induce la
formación de filopodios en cultivos primarios de neuronas de hipocampo.
58
Resultados
3.3 ESTUDIO DE POLIMORFISMOS EN EL GEN QUE CODIFICA PARA LA PROTEÍNA M6a
(GPM6A) EN PACIENTES CON DEPRESIÓN
La etiología de la depresión involucra tanto factores ambientales como genéticos
(Fava et al. 2000). Los genes involucrados en la enfermedad no han sido todavía
determinados. Sin embargo, se han hallado polimorfismos asociados a la patogénesis de la
depresión y/o comportamientos suicidas en genes relacionados con el crecimiento de
neuritas y plasticidad sináptica, y en genes cuya expresión se encuentra modulada por el
estrés y el tratamiento con antidepresivos (Bellivier et al. 1998; Kunugi et al. 2004; Tadokoro
et al. 2005; van West et al. 2006; Iga et al. 2007; Sarchiapone et al. 2008). Dado el rol
descripto en este trabajo para M6a en la extensión de procesos y en la plasticidad neuronal,
y debido a la regulación de su expresión por tratamientos de estrés y antidepresivos (Alfonso
et al. 2004; Alfonso et al. 2006), decidimos analizar la secuencia correspondiente al gen que
codifica para la proteína M6a (GPM6A) en ADN genómico de pacientes con depresión.
Muestras de ADN genómico de 28 personas (17 mujeres y 9 hombres) diagnosticadas
con distintos tipos de depresión fueron utilizadas como molde en reacciones de PCR. En un
principio se amplificaron las regiones correspondientes a todos los exones (secuencias
presentes en el ARNm maduro) del gen GPM6A. Se analizaron estas regiones ya que una
alteración en los exones es más probable que altere la función y/o la expresión de la
proteína. Los productos de amplificación fueron luego secuenciados y se analizó la existencia
de alteraciones. Como se muestra en la figura 29 A, se han descripto 12 polimorfismos en los
exones del gen GPM6A humano. La secuenciación de nuestras muestras no reveló la
existencia de ningún otro sitio polimórfico en estos exones. Mientras realizábamos estos
estudios, se publicó una investigación en la que se asociaba un polimorfismo en el segundo
intrón del gen GPM6A (rs10520303) con un subgrupo de pacientes con síntomas depresivos
dentro de una población de individuos diagnosticados con esquizofrenia (Boks et al. 2007).
Por este motivo, también amplificamos y analizamos esta región en nuestras muestras. La
figura 29 B muestra una tabla con las frecuencias genotípicas y alélicas en los distintos sitios
polimórficos obtenida para los pacientes con depresión y las frecuencias publicadas en la
base de datos NCBI (National Center for Biotechnology Information) para una población de
origen europeo (HapMap-CEU), ya que nuestras muestras analizadas provenían de pacientes
suecos. Como se observa en la tabla de la figura 29, la mayoría de los sitios resultaron no ser
polimórficos en la población estudiada. Para dos de estos sitios (polimorfismos 6 y 11 en la
figura 29), la base de datos tampoco muestra polimorfismos en la población de origen
59
Resultados
europeo analizada. Para los otros sitios que no resultaron ser polimórficos en nuestra
muestra no existe información acerca de la frecuencia alélica ni genotípica en las bases de
datos consultadas. En nuestras muestras, cinco sitios resultaron polimórficos. Para los
polimorfismos 8 y 9, no se tiene información sobre la frecuencia alélica ni genotípica en
bases de datos. Por otro parte, para los otros tres sitios (polimorfismos 7, 12 y 13, este
último recientemente asociado a síntomas de depresión en individuos diagnosticados con
esquizofrenia) se observan frecuencias genotípicas y alélicas en bases de datos que difieren
de lo observado en nuestra muestra. Sin embargo, la población estudiada es muy reducida y
se carecen de muestras control apropiadas para determinar estadísticamente si existe una
asociación entre alguno de estos polimorfismos y la depresión.
A
1
2
13
3
4
5
6
7
8
9
10 11 12
B
SNP
1
2
3
4
5
6
7
8
9
10
11
12
13
Identificación
rs11930023
rs11545191
rs11729990
rs11545192
rs11545193
rs1049820
rs3733398
rs1049835
rs6820412
rs11545194
rs12499061
rs17061725
rs10520303
Frecuencia genotípica
Frecuencia alélica
Pacientes con depresión
Base de datos
Pacientes con depresión
Base de datos
1 AA
1 CC
1 AA
1 AA
1 TT
1 GG
0,964 GG ; 0,036 GT
0,179 CC ; 0,5 CT ; 0,321 TT
0,892 AA ; 0,107 CA
1 CC
1 CC
0,892 TT ; 0,107 CT
0,821 GG ; 0,179 GC
ND
ND
ND
ND
ND
1 GG
0,867 GG ; 0,1 GT ; 0,033 TT
ND
ND
ND
1 CC
0,967 TT; 0,033 CT
0,9 GG ; 0,083 GC ; 0,017 CC
1A
1C
1A
1A
1T
1G
0,982 G ; 0,018 T
0,571 T ; 0,429 C
0,875 AA ; 0,125 AC
1 CC
1C
0,946 T ; 0,054 C
0,911 G ; 0,089 C
ND
ND
ND
ND
ND
1G
0,917 G ; 0,083 T
ND
ND
ND
1C
0,983 T ; 0,017 C
0,942 G ; 0,058 C
Figura 29. Polimorfismos en el gen GPM6A humano. A. Esquema representando al gen GPM6A humano. Se
destacan los exones (rectángulos), intrones (líneas punteadas) y las regiones codificantes que codifican para la
proteína M6a (rectángulos gris claro). Las flechas indican la posición de los polimorfismos descriptos en los
exones y un polimorfismo intrónico (rs10520303) recientemente asociado a pacientes con síntomas de
depresión entre individuos diagnosticados con esquizofrenia. B. Tabla que resume las frecuencias genotípicas y
alélicas determinadas en individuos suecos diagnosticados con distintos tipos de depresión (n = 28, de los
cuales 21 pacientes fueron diagnosticados con depresión mayor; 3 con desorden depresivo tipo NOS, del inglés,
Not Otherwise Specified; 2 con trastorno bipolar de tipo II; 1 con desorden esquizo-afectivo de tipo bipolar y 1
con distimia). También se indican las frecuencias genotípicas y alélicas para una población de origen europeo
(HapMap-CEU) publicada en la base de datos NCBI (National Center for Biotechnology Information). Los
polimorfismos cuya frecuencia genotípica y alélica en la muestra de pacientes con depresión difiere de la
publicada en base de datos se encuentran enmarcados en rojo. ND: información no disponible.
60
Discusión
4. DISCUSIÓN
En el presente trabajo se determinó que la proteína M6a, cuya expresión en el
hipocampo se encuentra alterada por la exposición al estrés crónico, induce la formación de
neuritas, filopodios/espinas y, probablemente, sinapsis. Luego, se extendió el análisis a otros
miembros de la familia de las PLPs, estableciéndose que la expresión de M6b y DM20 en el
hipocampo también se encuentra regulada por el estrés crónico. Además, se vio que M6b y
DM20 comparten con M6a la capacidad de inducir la formación de filopodios. Finalmente se
inició el estudio de polimorfismos en el gen GPM6A que podrían encontrarse asociados a la
depresión.
Estudios previos en nuestro laboratorio habían determinado que la expresión del
gen que codifica para la proteína M6a se encontraba alterada en diversos modelos animales
de estrés crónico y modulada por la administración de distintas drogas antidepresivas
(Alfonso et al. 2004; Alfonso et al. 2006). Sin embargo, al inicio de este trabajo de tesis, era
escasa la información sobre la función biológica de la proteína M6a. Los resultados aquí
mostrados indican que, en cultivos primarios de neuronas de hipocampo, la proteína M6a se
encuentra en la membrana del soma y los procesos neuronales, concentrándose en
estructuras ricas en actina tipo filopodios (figura 4). La sobreexpresión de M6a induce la
extensión de neuritas y la formación de filopodios/espinas en neuronas hipocampales
(figuras 6 y 7). Por el contrario, una reducción en los niveles de M6a, provoca una
disminución en la densidad de filopodios/espinas y en el número de puntos de sinaptofisina
en cultivos primarios de neuronas de hipocampo (figuras 11 y 12). Por lo tanto, se presentó
sobrada evidencia experimental de que M6a tendría un rol determinante en el crecimiento
de neuritas y en la formación de filopodios/espinas pudiendo estar, además, involucrada en
el establecimiento de sinapsis. Además, se estableció que la capacidad de M6a de inducir la
formación de filopodios no se encuentra restringida a cultivos primarios de neuronas de
hipocampo, sino que se extiende a cultivos celulares neuronales como N2a y PC12, y la línea
no neuronal COS-7 (figura 13).
Una vez identificada una función biológica de M6a, se extendió el análisis a otros
miembros de la familia de las proteínas proteolipídicas: M6b y PLP/DM20. Así, se determinó
que la expresión de M6b y DM20 también se encuentra reducida en el hipocampo de
animales sometidos a estrés crónico (figuras 20 B y 20 E). Por el contrario, la expresión de
PLP, una variante de splicing de DM20, no se encuentra modulada por la exposición a estrés
61
Discusión
crónico por confinamiento (figura 20 F). Al iniciar esta tesis, varias isoformas proteicas de
M6b habían sido descriptas, sin embargo, ninguna función biológica les había sido asignada
(Werner et al. 2001). En este trabajo se determinó que cuatro isoformas de M6b, que
difieren en sus extremos amino y carboxilo terminales pero que se localizan en la membrana
plasmática ya que poseen los dominios TM, promueven la formación de filopodios en
cultivos primarios de neuronas de hipocampo, en células neuronales N2a y células no
neuronales COS-7 (Figuras 24, 26 y 27). Por lo tanto, los extremos amino y carboxilo
terminales de M6b no serían determinantes para esta función. Por otro lado, una isoforma
citosólica que carece los dominios TM no induce la extensión de filopodios, demostrando
que las regiones TM y/o la localización en la membrana plasmática son esenciales para la
función de M6b en la formación de filopodios (figura 25). La cuantificación de la expresión
de distintas isoformas de M6b reveló que en el hipocampo de ratón adulto, las isoformas
que carecen los dominios TM se expresan de forma despreciable en comparación con las
isoformas de membrana (figura 22). Al analizar la capacidad de PLP y DM20 de inducir la
extensión de filopodios, se vio que DM20 induce la formación de filopodios, aunque en
menor medida que M6a, en tanto que PLP no comparte esta función con los otros miembros
de la familia (figuras 25, 26 y 27). Nuestros resultados revelan, además, que la isoforma PLP
se expresa aproximadamente 10 veces más que la isoforma DM20 en el hipocampo murino
adulto (figura 20 D).
4.1 M6a y M6b podrían estar involucradas en el remodelado neuronal observado en el
hipocampo de animales estresados crónicamente
El estrés crónico induce alteraciones plásticas en el hipocampo, caracterizadas por
una disminución en la ramificación de las dendritas apicales y una reducción en el largo total
de las dendritas, así como por una marcada retracción de las espinas y una reducida
densidad sináptica en las neuronas piramidales de la zona CA3 (Watanabe et al. 1992;
Magarinos et al. 1996; Sousa et al. 2000; Sandi et al. 2003; Stewart et al. 2005). También se
ha descripto en el hipocampo de animales estresados crónicamente, una reorganización
estructural en las terminaciones de las fibras musgosas, que incluye una reducción en su
superficie y en el número de sinapsis con las dendritas de las neuronas piramidales de la CA3
(Magarinos et al. 1997; Sousa et al. 2000).
La expresión de las glicoproteínas de membrana M6a y M6b se encuentra reducida
en el hipocampo de animales sometidos a estrés crónico. En el presente trabajo se demostró
62
Discusión
que, en cultivos primarios de neuronas hipocampales, la densidad de filopodios/espinas así
como el número de puntos sinápticos se encuentran modulados por los niveles de expresión
de estas proteínas. Por lo tanto, nuestros resultados sugieren que la disminución en los
niveles de expresión de M6a y M6b podría ser, en parte, responsable de las alteraciones
morfológicas observadas en el hipocampo de animales estresados crónicamente. De acuerdo
con esta hipótesis, M6a y M6b poseen una alta expresión en las neuronas piramidales de la
zona CA3 del hipocampo y en las neuronas granulares del giro dentado de ratón adulto (Yan
et al. 1996). En un trabajo reciente se demostró que, en el cerebro de rata adulta, la
proteína M6a se localiza en los axones de las neuronas del giro dentado que conforman la
vía de las fibras musgosas (Cooper et al. 2008). Estos axones, que constituyen la principal
ruta de comunicación entre el giro dentado y la zona CA3 del hipocampo, no están
mielinizados (Blackstad et al. 1961; Frotscher et al. 2006) y presentan protrusiones axonales
únicas tipo filopodios (Acsady et al. 1998). Resulta interesante destacar que M6a estaría
enriquecida en estas protrusiones (Cooper et al. 2008). Por lo tanto, la disminución en la
expresión de M6a podría estar específicamente involucrada en la remodelación observada
en las terminales de las fibras musgosas de animales sometidos a estrés crónico. Asimismo,
los aferentes glutamatérgicos de las fibras musgosas mediarían la atrofia de las neuronas
piramidales de la CA3 encontrada en animales estresados, ya que el daño es prevenido por
el tratamiento con fenitoína, una droga que reduce la liberación de aminoácidos excitatorios
(Watanabe et al. 1992), y por la administración de antagonistas de receptores de glutamato
tipo NMDA (Magarinos et al. 1995). De este modo, las alteraciones en las dendritas de las
neuronas piramidales de la zona CA3 también podrían responder a la expresión diferencial
de M6a en el hipocampo de animales estresados. La localización subcelular de la proteína
M6b no ha sido estudiada en el cerebro de animales adultos. Sin embargo, dada la expresión
del transcripto tanto en neuronas del giro dentado como de la zona CA3 (Yan et al. 1996),
M6b podría estar involucrada en el remodelado de las fibras musgosas así como en las
modificaciones de las dendritas de las neuronas piramidales de la zona CA3 observados en el
hipocampo de animales estresados.
Las consecuencias celulares de la expresión reducida de DM20 en el hipocampo de
animales estresados crónicamente aún deben ser evaluadas. Una relación directa entre la
expresión de DM20 y las alteraciones en las neuronas del hipocampo es difícil de concebir ya
que DM20 no se expresaría en células neuronales (Verity et al. 1988; Yan et al. 1993; Yan et
al. 1996).
63
Discusión
4.2 Evolución y homología funcional entre los miembros de la familia de las proteínas
proteolipídicas
Nuestros resultados revelan que M6a, M6b y DM20 están involucradas en la
formación de filopodios. La homología funcional encontrada entre estas tres proteínas
podría responder a la alta identidad aminoacídica que presentan, lo que podría explicarse en
términos de la evolución de los genes de la familia de las proteínas proteolipídicas. Como se
muestra en la figura 30, se cree que las proteínas proteolipídicas evolucionaron a partir de
un único gen ancestral presente en los bilaterados, emergiendo luego, en el linaje de los
vertebrados, tres genes homólogos a M6a, M6b y PLP/DM20 de mamíferos (Schweitzer et al.
2006). Por lo tanto, estas proteínas habrían evolucionado antes que la aparición de la
mielina, por lo que su función en la mielinización fue adquirida tiempo después. En
concordancia, DM20 (o su homólogo DM) emergió al mismo tiempo que la mielina,
mientras que el dominio exclusivo de PLP, que incrementaría la eficiencia de inserción en la
mielina (Trapp et al. 1997), fue adquirido con posterioridad. La alta identidad aminoacídica
entre DM20 y las proteínas neuronales M6a y M6b, podría explicar la homología funcional
en la inducción de la formación de filopodios y su regulación por estrés.
Homo (3)
Mus (3)
Mamíferos
Gallus(3)
Aves
Xenopus (5)
Danio (6)
Squalus (3)
Raja (3)
Anfibios
Teleósteos
Peces
cartilaginosos
Ciona (2) Caenorhabditis (1)
Agnatos
Ascidios
Nematodos
Anopheles (1)
Apis (1)
Bombyx (1)
Drosophila (1)
Artrópodos
Tetrapodos
V
IV
Vertebrados con mandíbula
III
Vertebrados
II
Cordados
I
Bilaterados
Figura 30. Evolución de los genes de la familia de las proteínas proteolipídicas. El esquema muestra la
evolución propuesta para los miembros de la familia de las PLPs. Los números entre paréntesis muestran la
cantidad de genes de proteínas proteolipídicas en cada género. Las flechas muestran las duplicaciones
genómicas propuestas. Los números romanos indican pasos trascendentales en la evolución de los genes de las
proteínas proteolipídicas. I: gen ancestral. II: duplicación del genoma en los cordados tempranos, dando como
resultando 2 genes homólogos a M6a y M6b. III: emergencia del tercer gen que codifica para una proteína
proteolipídica en los vertebrados (homólogo a DM20), al tiempo que aparece la mielina. IV: incorporación de
proteína homóloga a DM20 a la mielina. V: emergencia del exón específico de PLP en los tetrápodos. Adaptado
de Schweitzer et al., 2006.
64
Discusión
Si bien los miembros de la familia de las proteínas proteolipídicas comparten una alta
identidad aminoacídica, su patrón espacial y temporal de expresión en el sistema nervioso
murino varía considerablemente. La expresión más temprana de M6a se observa en
neuronas post mitóticas del cerebro y la médula espinal a partir del décimo día del
desarrollo embrionario (E10). Luego, en el cerebro adulto, M6a se expresa exclusivamente
en neuronas del hipocampo y de la corteza cerebral y en las células granulares del cerebelo
(Yan et al. 1996). En contraste, durante el desarrollo embrionario, M6b se localiza en la zona
ventricular de la médula espinal, encontrándose tanto en células neuronales hipocampales y
corticales, así como en la glía del cerebelo y de la corteza en el animal adulto (Yan et al.
1996). Por otro lado, la expresión de PLP/DM20 se limita a oligodendrocitos (Yan et al.
1996). Algunos estudios revelan la expresión de PLP/DM20, sólo a partir del primer día post
natal (P0) (Baron et al. 1993; Yan et al. 1996), mientras que otros la detectan en estadios
embrionarios (Ikenaka et al. 1992; Timsit et al. 1992; Yu et al. 1994).
El desarrollo de las neuronas hipocampales in vitro se inicia con la extensión de
neuritas del soma celular, especializándose luego estas extensiones en dendritas y axones
(Dotti et al. 1988). Aunque el mecanismo por el cual las neuritas se desarrollan no se
encuentra totalmente dilucidado, estudios recientes in vivo e in vitro muestran que la
formación de filopodios es un paso clave para el inicio de la neuritogénesis en neuronas
corticales (Dent et al. 2007; Kwiatkowski et al. 2007). La función en la extensión de neuritas y
la formación de filopodios descripta para M6a y M6b en el presente trabajo y sus patrones
de expresión sugieren que estas podrían estar involucradas en el desarrollo del sistema
nervioso, más específicamente en los primeros pasos de la neuritogénesis, así como en la
maduración neuronal. En concordancia con nuestros resultados, estudios recientes han
demostrado un rol para M6a en la extensión de neuritas en células neuronales de la retina
(Zhao et al. 2008).
En oligodendrocitos, la capacidad de M6b y DM20 de inducir la extensión de procesos
podría ser necesaria en los primeros pasos de la mielinización, en donde el crecimiento de
procesos ha sido observado (Trapp et al. 1997). Por otro lado, hace tiempo que se concibe
una función alternativa para DM20, independiente a la de un componente estructural de la
mielina o a la de un factor clave para la diferenciación y la supervivencia de los
65
Discusión
oligodendrocitos (Knapp 1996; Nadon et al. 1997). Esta hipótesis se basa en la expresión de
DM20 en células no mielinizantes como miocardiocitos, células embrionarias del sistema
nervioso y neuroblastomas (Campagnoni et al. 1992; Ikenaka et al. 1992; Timsit et al. 1992).
En concordancia, en el presente trabajo se describe una nueva función para la proteína
DM20 en la extensión de filopodios que no se encuentra restringida a células de fenotipo
neuronal, sino que también se observa en células COS-7.
4.3 Mecanismos que subyacerían la formación de filopodios mediada por las proteínas
proteolipídicas
Los miembros de la familia de las proteínas proteolipídicas han sido estudiados por
más de 50 años (Folch et al. 1951). Originalmente, fueron asociados con la extensión de
procesos hace 15 años (Lagenaur et al. 1992), y sólo han sido involucrados en la formación
de filopodios recientemente en nuestro laboratorio (Alfonso et al. 2005). Los mecanismos
mediante los cuales estas proteínas inducen la formación de filopodios son aún
desconocidos. Sin embargo, de acuerdo con el resultado de distintas investigaciones se han
generado diversas especulaciones. Todas las proteínas proteolipídicas involucradas en la
extensión de procesos son proteínas de membrana que compartirían una estructura que
incluye dos loops extracelulares que podrían interactuar con ligandos externos. Esta
hipótesis se encuentra sustentada por la evidencia experimental que la incubación con
anticuerpos anti M6a interfiere con la extensión de neuritas en cultivos neuronales
(Lagenaur et al. 1992). Las proteínas proteolipídicas también podrían interactuar con otras
proteínas de membrana. En este sentido, se ha descripto que PLP/DM20 forma un complejo
con integrinas en oligodendrocitos (Gudz et al. 2002). Además, se ha comprobado la
interacción de M6a con el receptor de opioides y se sugirió un rol para esta glicoproteína
en la regulación de la endocitosis y el tránsito intracelular de receptores acoplados a
proteína G (Wu et al. 2007; Liang et al. 2008). En nuestro laboratorio, actualmente se está
trabajando en la identificación de proteínas que interactúan con M6a, tanto ligandos
extracelulares, como proteínas de membrana y proteínas intracelulares.
Las proteínas proteolipídicas podrían encontrarse asociadas a microdominios de
membrana enriquecidos en lípidos (lipid rafts). De acuerdo con esta hipótesis, se ha
observado la interacción de PLP/DM20 con membranas ricas en colesterol (Simons et al.
2000). Los lipid rafts han sido asociados con el transporte intracelular de membranas y la
traducción de señales (Simons et al. 1997; Simons et al. 2000). En este sentido, DM20 ha
66
Discusión
sido involucrada en el transporte intracelular de distintas moléculas (Nadon et al. 1998) y la
expresión aberrante de PLP perturba la distribución celular del colesterol (Simons et al.
2002), lo que ha sido asociado con una interferencia en el tráfico intracelular de proteínas
(Butchbach et al. 2004). La presencia de M6a en fracciones de membranas ricas en lípidos
tipo lipid rafts está siendo actualmente evaluada en nuestro laboratorio.
Se ha sugerido que M6a podría actuar como un canal de calcio (Mukobata et al.
2002). En concordancia, alteraciones en la concentración de calcio intracelular han sido
involucradas en la regulación de la extensión de neuritas y en la actividad de filopodios y/o
espinas (Lau et al. 1999; Nikonenko et al. 2002). Sin embargo, en la actualidad no existen
evidencias suficientes para considerar que M6a sería un canal de calcio.
Los procesos de formación y crecimiento de neuritas, filopodios y espinas, se
encuentran gobernados por interacciones de adhesión celular y por las fuerzas resultantes
de la polimerización del citoesqueleto de actina (Luo 2002). Se ha demostrado que proteínas
involucradas en la estructura y dinámica de la actina pueden afectar la morfología de las
dendritas, el crecimiento de espinas y el establecimiento de sinapsis (Nakayama et al. 2000;
Zhang et al. 2001; Penzes et al. 2003; Zito et al. 2004). Si bien los estudios realizados en esta
tesis muestran que M6a no interacciona directamente con los microfilamentos de actina, ya
que la disrupción de los mismos no altera la localización de la proteína (figura 15), M6a
podría estar interactuando con otras proteínas involucradas en la regulación del
citoesqueleto de actina. La familia de proteínas Rho GTPasas constituye una vía de
señalización asociada a la regulación del citoesqueleto de actina en diversos tipos celulares,
incluyendo fibroblastos, células epiteliales y endoteliales, líneas neuronales y neuronas tanto
de animales vertebrados como de invertebrados (Hall 1998; Luo 2002). En este sentido, las
GTPasas pequeñas RhoA, Rac1 y Cdc42 han sido frecuentemente asociadas a la formación de
filopodios y espinas (Luo 2000; Nakayama et al. 2000). Nuestros resultados indicarían que la
formación de filopodios inducida por M6a no estaría mediada por ninguna de estas tres
GTPasas pequeñas. Sin embargo, M6a podría estar actuando a través de otros miembros de
la familia recientemente identificados, como Rif, RhoD, TC10 y Wrch1, que también han sido
involucrados en la remodelación del citoesqueleto de actina (Ridley 2006).
Con el fin de identificar aminoácidos clave de la glicoproteína M6a en la formación de
filopodios, nuestro laboratorio ha realizado un análisis de diversas mutantes de esta
proteína. En primer lugar, se mutaron los posibles sitios intracelulares de fosforilación,
construyéndose tanto mutantes simples para cada sitio, así como una mutante múltiple en
67
Discusión
donde todos los posibles sitios de fosforilación en los extremos amino y carboxilo terminales
han sido sustituidos. La sobreexpresión de todas estas mutantes de fosforilación, que
conservan su localización en la membrana plasmática, induce la formación de filopodios de
un modo similar a M6a wild type, tanto en cultivos primarios de neuronas de hipocampo
como en células N2a (Recúpero, M. resultados de nuestro laboratorio no publicados). Sin
embargo, el análisis de cultivos de neuronas hipocampales vivos por microscopía de time
lapse ha revelado que la motilidad de los filopodios inducidos por la mutante múltiple en los
sitios intracelulares de fosforilación, es menor que la de las protrusiones promovidas por la
sobreexpresión de M6a wild type (Brocco, M. resultados de nuestro laboratorio no
publicados). La motilidad de los filopodios y/o espinas es clave para la plasticidad sináptica
ya que ha sido asociada con la formación de nuevas sinapsis (sinaptogénesis) y con el
remodelado de conexiones sinápticas preexistentes (Dunaevsky et al. 2003). Estudios de
fosfoproteómica de sinaptosomas de corteza cerebral humana, comprobaron que M6a se
encuentra fosforilada en el residuo S267 ubicado en el extremo carboxilo terminal
(DeGiorgis et al. 2005). Según programas de predicción, este residuo sería un sitio de
fosforilación para PKC. En concordancia, los sitios intracelulares de fosforilación para PKC
han sido propuestos como parte de un sistema de regulación para la función de M6a, ya que
el tratamiento de células PC12 con inhibidores de la PKC anula el efecto de esta proteína en
el incremento de calcio intracelular inducido por NGF (Mukobata et al. 2002).
Con el objeto de evaluar si la glicosilación de M6a mediaría los efectos en la
inducción de filopodios, se mutaron dos posibles sitios de N-glicosilación que se encuentran
localizados en el loop extracelular mayor. Estudios preliminares en cultivos de neuronas de
hipocampo y cultivos de células N2a muestran que la sobreexpresión de esta doble mutante
induce la formación de filopodios en niveles comparables a M6a wild type. Resultados
similares fueron obtenidos al mutar los residuos de cisteína presentes en el loop extracelular
menor. Estos sitios podrían resultar clave para el establecimiento de puentes disulfuro, lo
que podría ser necesario para el correcto plegamiento y función de la proteína. Sin embargo,
los primeros ensayos con estas proteínas revelan que estas mutantes mantienen su
localización celular, son reconocidas por el anticuerpo anti M6a e inducirían la formación de
filopodios en forma semejante a M6a wild type. Por otro lado, la mutante M6a C164A,
modificada en el loop extracelular mayor, presenta un cambio en la localización de la
proteína, que queda retenida en el retículo, probablemente por una alteración en el
plegamiento de la misma. Resulta interesante destacar que la mutación de dos cisteínas
68
Discusión
presentes en el loop extracelular mayor (M6a C174A C192A) da como resultado una proteína
que se localiza en la membrana plasmática pero que no es reconocida por el anticuerpo anti
M6a. Esta mutante es incapaz de aumentar la densidad de filopodios en neuronas
hipocampales y en cultivos de N2a, sugiriendo un rol clave para la conformación del loop
extracelular mayor en la formación de filopodios (Fuchsova, B. resultados de nuestro
laboratorio no publicados).
Como se describió en este trabajo, las mutantes en los posibles sitios de
palmitoilación y fosforilación extracelulares conservan su localización celular y la capacidad
de inducir la formación de filopodios, indicando que estas modificaciones post
traduccionales no serían necesarias para esta función de M6a. Sin embargo, no se descarta
la relevancia de estas modificaciones para otras funciones tales como la motilidad de las
protrusiones inducidas, como ha sido demostrado para la mutante en los sitios de
fosforilación intracelulares (Brocco, M. resultados de nuestro laboratorio no publicados), u
otras propiedades aún no descriptas para M6a.
Si bien representa un tema de activa investigación en nuestro laboratorio, el
mecanismo por el cual las proteínas proteolipídicas inducen la formación de filopodios, no
ha sido aún esclarecido. El entendimiento de los procesos involucrados en la formación de
filopodios por estas proteínas, sería importante, no sólo para comprender el funcionamiento
de las mismas, sino que también podría contribuir en la identificación de mecanismos
moleculares responsables de las alteraciones plásticas observadas en el hipocampo de
animales estresados y en la acción de drogas antidepresivas.
4.4 M6a y la acción terapéutica de los antidepresivos
A pesar de investigaciones realizadas durante décadas, los mecanismos que subyacen
la acción terapéutica de los antidepresivos no han sido acabadamente dilucidados. Al
identificarse el mecanismo de acción agudo de los antidepresivos sobre la actividad de los
neurotransmisores monoamínicos, se elaboró la teoría monoamínica de la depresión. Según
esta teoría, la depresión es causada por una disfunción en las sinapsis serotoninérgicas y
noradrenérgicas (Owens 2004). Sin embargo, las drogas antidepresivas deben ser
suministradas por períodos superiores a dos semanas para obtener resultados, lo que indica
que un aumento en la transmisión de sinapsis que involucran neurotransmisores
monoamínicos per se no sería el único mecanismo por el cual estas drogas ejercen sus
efectos terapéuticos.
69
Discusión
En los últimos años, se han formulado varias nuevas hipótesis acerca de la acción
terapéutica de las drogas antidepresivas que no resultan mutuamente excluyentes. Una
hipótesis propuesta por Florian Holsboer y sus colaboradores establece la disrupción del eje
HPA como causa de la depresión y atribuye la acción terapéutica de los antidepresivos a la
normalización de dicho sistema (Holsboer et al. 1996; Holsboer 2000). Otros investigadores
proponen que la depresión podría estar relacionada a alteraciones en la plasticidad
neuronal, que resulta revertida por el tratamiento con antidepresivos (Manji et al. 2001;
Fuchs et al. 2004). La neurogénesis, un caso particular de plasticidad neuronal, ha sido
involucrada en la etiología de la depresión y en el mecanismo de acción de los
antidepresivos en distintas publicaciones (Jacobs et al. 2000; Santarelli et al. 2003). La
hipótesis neurotrófica de la depresión y la acción de los antidepresivos sostiene que las
alteraciones neuroplásticas podrían ser consecuencia de una expresión diferencial de
neurotrofinas (Duman et al. 1997; Duman 2004). Las nuevas hipótesis, que involucran la
remodelación estructural, explicarían el retardo en la acción de los antidepresivos.
Los resultados del presente trabajo concuerdan con las hipótesis que establecen a la
plasticidad neuronal como base de la acción terapéutica de los antidepresivos. En
concordancia, se ha demostrado que la proteína M6a, cuyos niveles de expresión se
encuentra regulado por la administración de distintas drogas antidepresivas (Alfonso et al.
2004; Alfonso et al. 2006), está involucrada en plasticidad neuronal ya que promueve la
extensión de neuritas y la formación de filopodios/espinas (Alfonso et al. 2005). Resulta
importante destacar que las hipótesis que involucran a la plasticidad neuronal en la etiología
de la depresión y en la acción terapéutica de las drogas antidepresivas se basan en
correlaciones observadas entre individuos con depresión y/o tratamiento con antidepresivos
y remodelación neuronal. Sin embargo, todavía se desconoce si las alteraciones
estructurales son la causa, la consecuencia o simplemente correlacionan con los estados de
depresión y la acción de los antidepresivos.
4.5 Polimorfismo en el gen GPM6A asociado a síntomas de depresión
La depresión presenta en su etiología tanto factores ambientales como genéticos
(Fava et al. 2000; Lesch 2004). Entre los determinantes ambientales, se destaca la exposición
a situaciones de estrés (Kessler 1997; Kendler et al. 1999; Paykel 2001). Las bases genéticas
de la enfermedad aún constituyen un interrogante. Esto probablemente responda a la
existencia de un gran número de genes implicados, donde cada uno aporta un pequeño
70
Discusión
componente para el desarrollo de la patología (Burmeister 1999). Además, la participación
de un factor ambiental, dificulta aún más la identificación del componente hereditario.
Estudios de resonancia magnética han revelado una reducción selectiva del volumen del
hipocampo en pacientes con depresión (Sheline et al. 1999; Bremner et al. 2000; Mervaala
et al. 2000; MacQueen et al. 2003; Sheline et al. 2003). La reducción en el volumen de la
formación hipocampal podría deberse, en parte, a alteraciones en la morfología celular y la
plasticidad neuronal. Por ello, se han investigado alteraciones en genes involucrados en el
crecimiento de neuritas y en plasticidad sináptica en relación a desórdenes depresivos. Así,
se han descripto polimorfismos en el gen del receptor de neurotrofinas p75NTR (Kunugi et
al. 2004), en el factor de crecimiento neuronal BDNF (Iga et al. 2007; Sarchiapone et al.
2008) y en la proteína activadora de RhoGTPasa GMIP (Tadokoro et al. 2005) asociados a la
patogénesis de la depresión y/o a comportamientos suicidas. También se han examinado
polimorfismos en genes cuya expresión se encuentra modulada por el estrés y el
tratamiento con antidepresivos. De este modo, se hallaron polimorfismos asociados a la
depresión en los genes que codifican para el transportador de serotonina 5HTT (Bellivier et
al. 1998) y el receptor de glucocorticoides NR3C1 (van West et al. 2006).
Dadas las características descriptas en el presente trabajo de tesis para la proteína
M6a y dada la regulación de su expresión por tratamientos de estrés y antidepresivos
descritos en nuestro laboratorio (Alfonso et al. 2004; Alfonso et al. 2006), el gen que codifica
para la proteína M6a (GPM6A) representa un candidato a tener en cuenta en estudios
asociados a la depresión. De hecho, una publicación reveló la asociación entre un
polimorfismo en el segundo intrón del gen GPM6A y síntomas depresivos dentro de un
grupo de pacientes diagnosticados con esquizofrenia (Boks et al. 2007). De este modo se
estableció, por primera vez, un vínculo de relevancia clínica entre M6a y los síntomas de la
depresión que ya había sido sugerido en nuestro laboratorio en base a los resultados
obtenidos durante el presente trabajo de tesis (Alfonso et al. 2005). El polimorfismo
encontrado en los pacientes esquizofrénicos con síntomas de depresión podría alterar la
expresión y/o la función de la proteína. Sin embargo, esto aún no ha sido estudiado. En esta
tesis, se inició un estudio de polimorfismos en el gen GPM6A a partir de muestras de ADN
genómico de pacientes diagnosticados con depresión. En estas muestras se han encontrado
tres polimorfismos (incluyendo al descripto por Boks et al., 2007 en pacientes con
esquizofrenia) cuya frecuencia genotípica y alélica difiere de la descripta en bases de datos
(figura 29). Para determinar si realmente existe una asociación entre alguno de estos
71
Discusión
polimorfismos y la depresión, habría que estudiar la frecuencia genotípica y alélica de los
mismos en una población control adecuada y, probablemente, en una muestra más amplia
de pacientes con depresión.
72
Conclusiones generales
5. CONCLUSIONES GENERALES
El objetivo de este trabajo de tesis se centró en la caracterización funcional de la
proteína M6a, cuya expresión en el hipocampo se encuentra modulada por la exposición al
estrés crónico y la administración de drogas antidepresivas (Alfonso et al. 2004; Alfonso et
al. 2006), así como en el estudio de M6b y PLP/DM20, otros miembros de la familia de las
PLPs a la cual M6a pertenece, de modo tal de contribuir al establecimiento de las bases
moleculares del estrés. Se ha demostrado que el estrés crónico produce alteraciones
estructurales en el hipocampo que pueden ser revertidas por el tratamiento con
antidepresivos. Sin embargo, los mecanismos moleculares que subyacen las modificaciones
neuroplásticas y la acción de las drogas antidepresivas no han sido aún dilucidados. La
comprensión de estos procesos podría resultar clave para el entendimiento y el tratamiento
de enfermedades relacionadas al estrés tales como la depresión.
Las conclusiones del presente trabajo son:
•
Similar a lo descripto para M6a, la expresión de M6b y DM20 también se encuentra
reducida en el hipocampo de animales sometidos a estrés crónico.
•
La proteína M6a juega un rol clave en la extensión de neuritas, la formación de
filopodios/espinas, y muy probablemente en el establecimiento de sinapsis.
•
M6b y DM20 también inducen la formación de filopodios.
•
La expresión diferencial de las glicoproteínas de membrana M6a y M6b podría contribuir
a las alteraciones plásticas encontradas en el hipocampo de animales estresados
crónicamente.
En base a los resultados obtenidos, las proteínas proteolipídicas podrían estar
involucradas en enfermedades relacionadas al estrés. Es por eso que iniciamos el estudio de
la existencia de polimorfismos asociados a la depresión en el gen GPM6A. Como conclusión,
creemos que las proteínas proteolipídicas deberían ser consideradas en trastornos
relacionados al estrés como la depresión.
73
Perspectivas futuras
6. PERSPECTIVAS FUTURAS
En el presente trabajo se ha descripto un rol para las proteínas proteolipídicas en la
plasticidad neuronal y se ha sugerido una relación entre estas proteínas y enfermedades
relacionadas al estrés crónico tales como la depresión. El mecanismo de acción mediante el
cual estas proteínas producen los efectos observados representa actualmente un tema de
activa investigación en nuestro laboratorio. Por un lado, se están realizando estudios
funcionales con distintas mutantes de M6a de forma tal de identificar aminoácidos clave
para la función de M6a en la formación de filopodios. Además, mediante ensayos de
inmunoprecipitación, se intenta identificar ligandos externos y/o internos de M6a de forma
tal de establecer efectores de la formación de filopodios/espinas y las vías de traducción de
señales involucradas en la función de esta proteína. Por otra parte, se está evaluando la
presencia de M6a en microdominios de membranas ricos en lípidos (lipid rafts), lo que
podría ser útil en la identificación de los mecanismos moleculares involucrados en la función
de M6a. Asimismo, se está caracterizando más detalladamente las protrusiones inducidas
por M6a, analizando su estabilidad y su rol en la formación de sinapsis.
En base a los resultados obtenidos nos resulta interesante estudiar la función de M6a
y M6b in vivo. Actualmente se está evaluando la capacidad de estas proteínas de inducir la
formación de filopodios y/o espinas en el cerebro de ratón mediante la inyección en el
hipocampo de partículas virales que median la sobreexpresión de M6a y M6b. Además, se
están estudiando alteraciones fenotípicas y comportamentales en una línea hipomórfica
para M6 (ortólogo a M6a) de Drosophila melanogster.
Para evaluar la importancia de las proteínas proteolipídicas en el comportamiento de
mamíferos sería muy útil estudiar ratones con niveles de expresión nulos o reducidos (knock
out y/o knock down) de M6a y/o M6b. Dado el rol descripto para estas proteínas en la
formación de filopodios/espinas, se podrían realizar ensayos de memoria y/o aprendizaje, ya
que sea ha descripto que la plasticidad neuronal es vital para estos procesos. También, dada
la relación encontrada entre el estrés y la expresión de estas proteínas, sería relevante
realizar estudios de ansiedad y anhedonia, tanto en ratones que subexpresen como en
ratones que sobreexpresen M6a y/o M6b en el hipocampo. Por último, sería interesante
estudiar el efecto del estrés crónico en animales que expresen altos niveles de M6a y/o
M6b.
74
Perspectivas futuras
La expresión de M6a, M6b y DM20 se encuentra reducida en el hipocampo de
animales sometidos a estrés crónico. Los factores que regulan la expresión de estos genes
todavía son deconocidos. Sería relevante conocer los mecanismos involucrados en la
regulación de la expresión de estos genes. Es por ello que en nuestro laboratorio se han
iniciado estudios con el fin de identificar la región promotora del gen GPM6A y los factores
de transcripción que regulan su expresión.
Finalmente, sería importante continuar con los estudios de polimorfismos en los
genes que codifican para las proteínas protelipídicas en individuos con depresión. De esta
forma, se podría confirmar la existencia de una asociación entre estas proteínas y la
depresión.
75
Materiales y métodos
7. MATERIALES Y MÉTODOS
7.1 Cultivos celulares
Cultivos primarios de neuronas de hipocampo
Hipocampos de embriones de ratas Wistar, criadas en la Facultad de Veterinaria y
Agronomía de la Universidad de Buenos Aires, Buenos Aires, Argentina, de 18-19 días de
gestación fueron removidos quirúrgicamente e incubados en solución de Hank’s con 0,25 %
tripsina por 15 minutos a 37 oC. Los tejidos fueron luego disociados a través de pasajes por
pipetas Pasteur afinadas, en MEM o Advanced MEM con 2 mM glutamina, 10 M piruvato
de sodio, 100 U/ml penicilina y 100 g/ml estreptomicina (MEM 1X), con el agregado de 10
% (v/v) suero equino. Las células fueron plaqueadas en cubreobjetos de vidrio previamente
incubados con 0,1 mg/ml poli-L-lisina hidrobromuro (Sigma, St.Louis, MO) y 20 g/l
laminina (Gibco, Carlsbad, CA) a densidades de 20.000-50.000 células/cm2. Luego de 2-4 hs
los medios fueron cambiados a MEM/N2 (MEM 1X con 1 g/l ovoalbúmina y suplemento B27
de Gibco).
Líneas celulares
Las líneas N2a y COS-7 se cultivaron en D-MEM con 10 % (v/v) suero fetal bovino,
penicilina y estreptomicina. Para las células PC12, el medio indicado fue suplementado con 5
% suero de caballo y las células fueron mantenidas en placas tratadas con poli-L-lisina. Los
medios fueron cambiados cada 2-4 días. Para los ensayos de cuantificación del porcentaje de
células con filopodios, se utilizó 20 % (v/v) de suero fetal bovino para evitar la diferenciación
de las células.
7.2 Ensayos de inmunocitoquímica
Las células fueron fijadas con PFA al 4 %, sacarosa al 4 % en PBS a temperatura
ambiente durante 20 minutos y luego permeabilizadas con 0,1 % Triton X-100 en PBS por 2
min. Los cultivos fueron bloqueados en 3 % BSA en PBS durante por lo menos 1 hora a
temperatura ambiente seguido de la incubación con el anticuerpo primario en 3 % BSA en
PBS a 4 oC por 14-16 hs y la subsiguiente incubación con el anticuerpo secundario (previo
lavado con PBS) a 37 oC por 1 hora. Los preparados fueron lavados con PBS y agua y
montados en portaobjetos con FluorSave Reagent (Calbiochem, San Diego, CA).
76
Materiales y métodos
Los anticuerpos primarios utilizados fueron: anti M6a IgG de rata monoclonal 1/250
(Medical & Biological Laboratories Co., Ltd, Japan), faloidina conjugada a rodamina 1/1000
(Molecular Probes) anti -tubulina IgG de ratón monoclonal 1/2000 (Sigma, St Louis, MO),
suero de conejo anti sinaptofisina 1/500 (Synaptic Systems, Gottingen, Germany), suero de
conejo anti espinofilina 1/500 (US Biological, MA, USA), anti-MAP2 IgG de ratón monoclonal
1/200 (Sigma) y anti Tau-1 IgG de ratón monoclonal 1/500 (provisto gentilmente por L.I.
Binder). Los anticuerpos secundarios utilizados fueron: anti IgG ratón conjugado a Alexa
Fluor 488 1/1000 (Molecular Probes, Eugene, OR) o a rodamina 1/2000 (Pierce, USA), anti
IgG conejo conjugado a Alexa Fluor 350 1/200, a Alexa Fluor 488 1/1000 o a Alexa Fluor 594
1/300 (Molecular Probes).
7.3 Ensayos de despolimerización de la F-actina, marcación de las membranas celulares e
identificación de las células viables
Para desestabilizar el citoesqueleto de actina, los cultivos primarios de neuronas
fueron tratados con 2,5 M latrunculina A (Sigma) durante 18 hs, y los cultivos de N2a con
citocalasina D 5 M durante 5 hs. Para visualizar las membranas, las neuronas fueron
tratadas con el colorante lipofílico DiI: perclorato de 1,1’-dioctadecyl-3,3,3’,3’tetrametilendocarbocianina DiOC18 (Molecular Probes) 1/1000 en PBS a 37 oC por 5
minutos, luego lavadas en PBS, fijadas y montadas. Para identificar las células viables, los
cultivos se incubaron en una solución del colorante Trypan-Blue en PBS durante 3 minutos y
se contaron las células teñidas de azul y no teñidas en campos seleccionados al azar hasta 5
minutos después de la tinción.
7.4 Construcción de los plásmidos utilizados en las transfecciones
Para la expresión de proteínas fusionadas a GFP se utilizó el plásmido de expresión
eucariota pEGFP-C1 (Clontech). Para la construcción GFP::M6a, se realizó la amplificación de
la región codificante del gen M6a (desde el primer codón ATG hasta el codón stop, en total
834 pb) utilizando como templado ADNc de hipocampo de ratón y oligonucleótidos 5’ y 3’
con el agregado de secuencias para las enzimas de restricción Apa I y Kpn I, respectivamente.
El fragmento M6a amplificado se insertó en fase en los sitios Apa I – Kpn I presentes en el
sitio de clonado del vector (en la zona 3’ de la secuencia que codifica para la GFP).
Para las construcciones GFP::M6b TMD, GFP::M6b TMD, GFP::M6b TMD,
GFP::M6b TMD y GFP::M6b se diseñaron oligonucleótidos 5’ y 3’ que amplificaban la
77
Materiales y métodos
región codificante de las distintas isoformas con el agregado de secuencias para las enzimas
de restricción Xho I y Bam HI, respectivamente. Los fragmentos amplificados fueron
insertados en fase en los sitios Xho I y Bam HI presentes en el sitio de clonado del vector.
Para las construcciones GFP::PLP y GFP::DM20, las regiones codificantes fueron amplificadas
con oligonucleótidos 5’ y 3’ que amplificaban la región codificante de las distintas isoformas
con el agregado de secuencias para las enzimas de restricción Xho I y Eco RI,
respectivamente y clonadas en esos sitios presentes en el sitio de clonado del vector. La
siguiente tabla muestra los oligonucleótidos utilizados.
Nombre
Secuencia
M6a 5´ Kpn I
5´ GGT ACC ATG GAA GAG AAT ATG GAA GAA GGA 3´
M6a 3´ Apa I
5´ GGG CCC TTA TGT GTA TGC ATT GAG CCG 3´
M6b 5´ Xho I
5´CTC GAG CCA TGG GTT GCT TCG AAT GCT 3´
M6b 5´ Xho I
5´CTC GAG GTA TGA AGC CAG CCA TGG AAA C 3´
M6b 3´ Bam HI
5´ GGA TCC TTA AGT GTA AGA ATT GAG TTG TTC T 3´
M6b 3´ Bam HI
5´ GGA TCC TTA GAA CTT AGT GCA GCA GTC TT 3´
M6b 3´ Bam HI
5´ GGA TCC TTA GCA GTC CCA TCT TCC CA 3´
PLP/DM20 5´ Xho I
5´GTC TCG AGC TAT GGG CTT GTT AGA GTG TTG 3´
PLP/DM20 3´ Eco RI
5´ ACG AAT TCT CAG AAC TTG GTG CCT CG 3´
Tabla 1. Oligonucleótidos utilizados para la amplificación de las secuencias de interés y su clonado como
proteína de fusión a GFP. Subrayadas se muestran las secuencias blanco de las enzimas de restricción. En itálica
se indican los tripletes correspondientes a los codones que codifican para las metioninas iniciales y los codones
de terminación de la traducción.
Para la construcción VSVG::GFP, el ADNc de VSVG (gentilmente provisto por el Dr
Maccioni, Universidad de Córdoba, Argentina) fue clonado en fase en los sitios Eco RI/Bam
HI presentes en el sitio de clonado del vector pEGFP-N1 (Clontech).
Para la expresión de proteínas de forma independiente a GFP, se utilizó el vector
pEGFP-IRES2 (Clontech). Para la construcción GFP+M6a, la región codificante para la M6a
previamente clonada en el vector pGEMT-easy, fue obtenida a partir de la digestión de los
sitios EcoRI del vector y se insertó en los sitios Eco RI del vector. Para las construcciones
GFP+M6b TMD, GFP+M6b TMD, GFP+M6b TMD y GFP+M6b TMD, las secuencias
previamente clonada en el vector pEGFP-C1 fueron digeridas con la enzimas Xho I y Bam HI y
clonadas en esos mismos sitios presentes en el sitio de clonado del vector pEGFP-IRES2.
78
Materiales y métodos
Todas las secuencias fueron confirmadas por secuenciación automática antes de realizar las
transfecciones.
Para la construcción de las distintas mutantes de M6a en los posibles sitios de
palmitoilación y fosforilación se utilizó la siguiente estrategia: se diseñó un oligonucleótido
sentido de aproximadamente 30 pb que incluía la secuencia que se deseaba mutar
flanqueada por aproximadamente 15 pb en cada extremo. Además, se diseñó un
oligonucleótido antisentido también de 30 pb complementario al oligonucleótido sentido a
partir de la primera base río arriba de la mutación, de modo tal que este oligonucleótido no
contiene la mutación ni hibrida con esa parte de la secuencia. Estos oligonucleótidos son
utilizados en una PCR en donde se emplea como templado el plásmido con la secuencia que
se desea mutar. Durante la PCR, se amplifica todo el plásmido. El producto de PCR es luego
tratado con la enzima de restricción Dpn I que sólo digiere secuencias metiladas. Por lo
tanto, el templado de la PCR que, al provenir de un cultivo bacteriano, se encuentra
metilado es digerido mientras que el producto de PCR con la mutación deseada, al no
encontrarse metilado, no es degradado por la incubación con Dpn I. El producto de PCR,
luego de tratado con Dpn I, es utilizado para transformar bacterias. Una vez obtenidas las
colonias, se purifica el ADN plasmídico y se confirma la presencia de la mutación deseada
por secuenciación. La tabla a continuación muestra los oligonucleótidos utilizados.
Nombre
Secuencia
M6A C14S F
5´ AAGGACAGACACAGAAAGGGAGCTTCGAGTGCTGCATTA 3´
M6a C14S R
5´ CCCTTTCTGTGTCTGTCCTTCTTCCATATT 3´
M6a C17S C18S F
5´ CAGAAAGGGTGCTTCGAGAGCAGCATTAAATGCCTGGGAG 3´
M6a C17S C18S R
5´ CTCGAAGCACCCTTTCTGTGTCTGTCCTTC 3´
M6a C21S F
5´ GCTTCGAGTGCTGCATTAAAAGCCTGGGAGGTATTCCCT 3´
M6a C21S R
5´ TTTAATGCAGCACTCGAAGCACCCTTTCTG 3´
M6a C122S F
5´ GACTTCAAAATCACCACCAGTGGCAGATGTGTGAGC 3´
M6a C122S R
5´ GGTGGTGATTTTGAAGTCTCCATAGAGAT 3´
M6a C125S F
5´ AAATCACCACCTGTGGCAGAAGTGTGAGCGCTTGGTT 3´
M6a C125S R
5´ TCTGCCACAGGTGGTGATTTTGAAGTCTC 3´
M6a C246S F
5´ TGGGCCTATGTGAAAGATGCCAGCCGCATGCAGAAGTAC 3´
M6a C246S R
5´ GGCATCTTTCACATAGGCCCAGTTGGCAGAC 3´
M6a T60A F
5´ TGGAACAGTCAACATTCTGCAGGCCTACTTTGAGTTGGCAAG 3´
M6a T60A R
5´ CTGCAGAATGTTGACTGTTCCAGAAAGGGCTTC 3´
M6a T67A F
5´ CTACTTTGAGTTGGCAAGGGCTGCTGGAGACACACTGGATG 3´
M6a T67A R
5´ CCTTGCCAACTCAAAGTAGGTCTGCAGAATG 3´
79
Materiales y métodos
M6a T76A F
5´ CTGGAGACACACTGGATGTTTTCGCTATGATTGACATCTTTAAGTATG 3´
M6a T76A R
5´ GAAAACATCCAGTGTGTCTCCAGCAGTCCTTGCCAAC 3´
M6a T166A F
5´ GACCATCTGCCGGAACACCGCTCTAGTGGAGGGAGCAAATC 3´
M6a T166A R
5´ GGTGTTCCGGCAGATGGTCCACACATTGAAATAC 3´
Tabla 2. Oligonucleótidos utilizados para la construcción de las distintas mutantes en los posibles sitios de
palmitoilación y fosforilación. Subrayadas se muestran las bases que difieren de la secuencia original.
7.5 ARN de interferencia
Los ARN doble cadena de 21 pb para M6a fueron sintetizados y adquiridos en la
empresa Dharmacon (CO, USA). El diseño y la elección de la secuencia se realizaron
mediante el programa ofrecido por el fabricante (www.dharmacon.com). Las secuencias
utilizadas fueron: 5’-AAG GAU GUG UGA AUC UAC UGA-3’ para M6a siRNA1 y 5'-AAC GGC
UGC UUU CUU UGU CUA-3' para M6a siRNA2. Estas secuencias no poseen homología con
ningún otro ARNm conocido. Los siRNA control correspondieron a una mezcla de ARN doble
cadena de 21 pb de secuencia homóloga a la región codificante de la GFP.
7.6 Transfección de los plásmidos y el ARN de interferencia
Para las transfecciones celulares se usó el reactivo Lipofectamina 2000 (Invitrogen),
siguiendo las instrucciones del fabricante. Se utilizaron 2-3 g de ADN plasmídico o 40 pmol
de siRNA, mezclados con 1 ó 2 l de Lipofectamina, para neuronas o líneas celulares,
respectivamente, para cada pocillo de 2 cm2 de superficie (placas de 24 pocillos). Para las
placas de 10 cm de diámetro, utilizadas para los ensayos de activación de Rho GTPasas, se
usaron 40 g de ADN plasmídico y 60 l de lipofectamina. Para los pocillos de 10 cm2 de
superficie (placas de 6 pocillos) utilizadas para la cuantificación de ARNm de M6a en cultivos
tratados con siRNA, se utilizaron 200 pmol de siRNA y 5 l de lipofectamina. Las células se
incubaron con las mezclas de transfección durante 4-6 hs y luego se cambió el medio de
cultivo.
7.7 Cuantificación de células, procesos neuronales y puntos de sinaptofisina
Para calcular el número de neuritas primarias por célula, se cuantificaron las
estructuras marcadas con anticuerpos anti -tubulina. Se contaron entre 40 y 50 células por
grupo (transfectadas con GFP::M6a o GFP), provenientes de tres experimentos
80
Materiales y métodos
independientes. Se calcularon las medias para el total de células y las diferencias fueron
analizadas estadísticamente por el test no paramétrico Mann Whitney U-test, de 2 colas.
En los ensayos con M6a, la densidad de filopodios/espinas (el número de
protrusiones teñidas con el marcador de membrana DiI en fragmentos de 20 m de largo de
neurita, seleccionados dentro de los 50 m desde el soma) se cuantificó en 65-70 procesos
de diferentes neuronas por grupo, provenientes de tres experimentos independientes o en
75-95 neuronas por grupo, de dos experimentos, en el caso de la sobreexpresión o la
interferencia, respectivamente. El número de puntos positivos para la marcación con el
anticuerpo contra sinaptofisina, se cuantificó en fragmentos 20 m de neuritas, tomados
desde el cuerpo celular. Se contaron 55-66 neuronas por grupo, provenientes de dos
experimentos independientes. En todos los casos, se calcularon las medias para el total de
neuritas examinadas y las diferencias fueron analizadas estadísticamente por el test no
paramétrico Mann Whitney U-test, de 2 colas.
En el caso de las líneas celulares, en los ensayos con GFP::M6a se clasificaron 200,
110 ó 130 células por grupo, de múltiples experimentos, para PC12, N2a o COS7,
respectivamente. Las células fueron clasificadas de acuerdo a la presencia o ausencia de
filopodios determinados por la tinción con faloidina y se calculó el porcentaje de células con
filopodios por grupo. Como control se utilizaron células sin transfectar del mismo preparado.
Se calcularon las medias de los porcentajes obtenidos en al menos tres preparados de
experimentos independientes y las diferencias estadísticas se analizaron con la prueba T de
Student. En los ensayos con GFP+M6a, se calcularon las medias de dos experimentos
independientes y las diferencias estadísticas se analizaron con la prueba T de Student.
En los ensayos en los que se utilizaron las distintas mutantes de M6a, al emplearse
cultivos de la línea celular N2a, se clasificaron al menos 40 células transfectadas y 40 células
sin transfectar en cada preparado en cuanto a si tenían o no filopodios, tal como lo revelaba
la tinción con faloidina. Se calcularon las medias de los porcentajes obtenidos en un mínimo
de 7 preparados de al menos 2 experimentos independientes y las diferencias estadísticas se
analizaron con la prueba T de Student. En los cultivos primarios de neuronas de hipocampo,
se cuantificó el número de protrusiones en 20 m de largo de al menos 60 neuritas por
grupo. Se calcularon las medias para el total de neuritas analizadas y las diferencias fueron
analizadas estadísticamente por ANOVA de un factor seguido por la prueba de Dunnet para
efectos post hoc versus el control negativo GFP y versus M6a wild type.
81
Materiales y métodos
En los ensayos con M6b, PLP y DM20, la densidad de filopodios/espinas (el número
de protrusiones en fragmentos de 20 m de largo de neurita) se cuantificó en al menos 80
procesos de diferentes neuronas por grupo. Se calcularon las medias para el total de
neuritas analizadas y las diferencias fueron analizadas estadísticamente por ANOVA de un
factor seguido por la prueba de Dunnet para efectos post hoc versus el control negativo GFP
y versus M6a.
Finalmente, en los ensayos con M6b y DM20 en las líneas N2a y COS7, se calculó el
porcentaje de células con filopodios en al menos 40 células transfectadas y 40 células sin
transfectar por preparado. Las medias de los porcentajes obtenidos en un mínimo de 6
preparados de al menos 2 experimentos independientes y las diferencias estadísticas versus
el control sin transfectar se analizaron con la prueba T de Student. También se comparó el
incremento en el porcentaje de células con filopodios entre las células transfectadas con
M6a, M6b y DM20.
Todos los cálculos estadísticos se realizaron con el programa Analyse-it® de Microsoft
Excel.
7.8 Ensayos de activación de GTPasas
Por cada ensayo, 3 x 106 células N2a o COS-7 fueron plaqueadas en tres placas de
cultivo de 10 cm de diámetro, un día antes de la transfección. A las 24 hs de la transfección,
se observó la eficiencia de transfección a través de la detección de fluorescencia. Los cultivos
donde por lo menos el 40% de las células mostraban señal fluorescente fueron utilizados
para los ensayos de purificación y detección de Cdc42, Rac1 o RhoA activas. Siguiendo las
instrucciones del fabricante (Cytoskeleton Inc., CO, USA), las células fueron lisadas en el
buffer de lisis provisto, y centrifugadas 5 minutos a 8000 rpm a 4 oC. Las concentraciones
proteicas de los sobrenadantes fueron cuantificadas con el reactivo de Bradford y cantidades
similares de proteína total (entre 5 y 8 mg) para cada muestra, fueron incubadas por una
hora a 4 oC en constante agitación con esferas de agarosa GST-PBD PAK (para cdc42 y Rac1)
o RBD Rhotekin (para RhoA). Luego de la incubación, las esferas de agarosa fueron lavadas 3
veces con el buffer de lavado y resuspendidas en buffer de Laemmli. Las proteínas
purificadas fueron ensayadas por Western blot con los anticuerpos comerciales primarios
anti-Cdc42 en oveja 1/200, anti Rac1 en conejo 1/250 o anti-RhoA en ratón 1/250
(Cytoskeleton) y secundarios anti IgG de oveja 1/5000 (Cytoskeleton), anti IgG de conejo
1/8000 (Sigma) y anti IgG de ratón 1/8000 (Sigma) conjugados a peroxidasa. Como control
82
Materiales y métodos
de carga, los extractos totales fueron ensayados por Western blot con el anticuerpo primario
anti -tubulina IgG de ratón monoclonal 1/2000 (Sigma, St Louis, MO) y el anticuerpo
secundario anti IgG de ratón 1/8000 (Sigma) conjugado a peroxidasa. La detección de la
señal del anticuerpo secundario se llevó a cabo mediante quimioluminiscencia con el
sustrato Super Signal (Super Signal West Pico Chemiluminescent Substrate, Pierce) y
exposición en placas radiográficas (Kodak).
7.9 Tratamiento de estrés
Se utilizaron ratones machos de la cepa C57BL/6 de entre 2 y 3 meses de edad
criados en el Instituto de Investigaciones Biotecnológicas de la Universidad de San Martín
(IIB-UNSAM), San Martín, Argentina. Los animales fueron mantenidos en grupo dentro de las
mismas jaulas, en habitaciones con temperatura controlada, ciclos de luz/oscuridad de 12
horas y acceso libre al alimento y agua. Cada animal fue pesado antes y después de los
tratamientos. Luego de 7 días sin tratamiento, los animales fueron inmovilizados 1 vez por
día durante 4 horas (desde las 11 hs hasta las 15 hs) en tubos de plástico ventilados (de 2,8
cm de diámetro por 11,5 cm de largo) sin acceso a agua o alimento. El tratamiento de 21
días consistió en 6 días de estrés seguido de un día sin estrés, durante 3 semanas. Los
animales control fueron mantenidos en las mismas condiciones que los grupos
experimentales, pero sin recibir ningún tratamiento.
7.10 Disección de los hipocampos y extracción del ARN total
Los ratones fueron sacrificados un día después de la última sesión de estrés. Los
cerebros fueron extraídos y colocados en hielo para la disección de los hipocampos que
fueron congelados inmediatamente y guardados en nitrógeno líquido hasta su utilización.
Los tejidos congelados fueron homogeneizados en reactivo de Trizol (Life Technologies, NY,
USA) usando un homogeneizador manual. El ARN total fue purificado de los homogenatos de
Trizol de acuerdo a las instrucciones del fabricante y almacenado a –70 oC. Para evaluar la
integridad del ARN, 2 l del ARN total fueron separados por electroforesis en gel de agarosa
al 1 % con bromuro de etidio para la detección de las bandas correspondientes a las
subunidades pequeña y grande (18S y 28S) de ARN ribosomal, y descartar así su
degradación.
83
Materiales y métodos
7.11 Purificación del ARN mensajero poli A+ y síntesis del ADN copia
El ARNm poli A+ fue aislado del ARN total con el kit PolyATract mRNA Isolation
System (Promega, Madison, USA) implementando el protocolo sugerido por el fabricante
pero con cantidades 10 veces menores de ARN total (10 g) y de cada reactivo en todos los
pasos. El volumen final de elución del ARNm fue de 25 l, que luego fue guardado a –70 oC.
Se utilizaron 4 l de ARNm como templado para la retrotranscripción con la enzima
Superscript II (InvitrogenTM Life Technologies, NY, USA). Se incubó el ARNm con
oligonucleótido poliT a 90 oC por 2 min y luego se conservó en hielo hasta el agregado de la
mezcla de reacción seguido de la incubación a 42 oC por 1 hora. Los reactivos y sus
concentraciones finales fueron: 1X Buffer de reacción, 10 mM DTT, 0,25 mM dNTPs, 200 U
enzima Superscript II, 50 ng/l Oligo dT. También se realizó un control negativo de la
transcripción reversa sin enzima para descartar la presencia de ADN genómico en las
muestras.
7.12 Ensayos de PCR en tiempo real
Las reacciones de PCR en tiempo real se llevaron a cabo en un equipo GeneAmp
5700, Sequence Detection System (PE Biosystems) utilizándose el kit comercial SYBR Green
PCR Core Reagents (PE Biosystems). Cada reacción (volumen total 25 ó 12,5 l) se realizó
utilizando como templado 4 l de ADNc diluido (diluciones entre 1/20 y 1/30 de la reacción
de transcripción reversa, según el experimento). Los reactivos se usaron en las siguientes
concentraciones finales: 1X SYBR Green Reaction Buffer; 3mM MgCl; 1mM dATP; 1mM
dUTP; 1mM dGTP; 1mM dCTP; 0,3 M de cada primer; 0,01 U/ml UNG-Enzyme y 0,025 U/ml
Taq Gold DNA Polymerase. Las reacciones se incuban primero a 50 oC por 2 minutos para
permitir la actividad uracil N’-glicosilasa de la UNG-Enzyme que inactiva cualquier templado
de ADN que contenga residuos UTP, es decir, los que provienen de previas PCRs usando
dUTP en vez de dTTP, y así evitar las contaminaciones por producto final. Luego se continúa
con una incubación a 95 oC por 10 minutos, donde se inactiva la UNG-enzyme y se activa la
polimerasa (acoplada a un inhibidor termolábil), y el ciclado se realiza 40 veces a 95 oC por
15 segundos (desnaturalización) y 60 oC por 1 minuto (hibridación y extensión de los
primers). Para verificar la amplificación de un producto único de PCR, todas las reacciones se
analizaron con el protocolo de disociación por temperatura luego del ciclo final de la PCR
(Ririe et al. 1997).
84
Materiales y métodos
Los oligonucleótidos utilizados fueron diseñados usando el programa Primer Express
1.5 (PE Biosystems). A continuación se muestran las secuencias de los mismos.
Nombre
Secuencia
M6a sentido
5’ AAA TAA TGA TGT AGC CTG ACA AGA AAT TT 3’
M6a antisentido
5’ AAT GCA CTT ACA CTG AAG GAG GAA T 3’
M6b 3´UTR sentido
5´ AGC AGT GGA GGT GCT GTT AAG AGT 3´
M6b 3´UTR antisentido
5´ GGC TTT AGA CAC CGC CTC TTC T 3´
PLP/DM20 3´UTR sentido
5´AAT TGT TTA TCT CTT GTT TGG AGT TGT ATC 3´
PLP/DM20 3´UTR antisentido
5´AGA ATC ATC CTC CAG GTC TTT CTG 3´
PLP sentido
5´ GGC CTG AGC GCA ACG GTA 3´
DM20 sentido
5´ GGC CTG AGC GCA ACG TTT G 3´
PLP/DM20 antisentido
5´AGG AGC CAT ACA ACA GTC AG 3´
M6b exón Ia sentido
5´ TCC CGT CAG TCT CCA ACC A 3´
M6b exón Ia antisentido
5´ CCC AGA CAC TTG ATG CAG CA 3´,
M6b exón Ib sentido
5´ TAT GGT CGC CTG CTC CTT G 3´
M6b exón Ib antisentido
5´ CGC TCT GCC TAC TGG TCC A 3´
M6b exón III sentido
5´ AAA TAG ATT CAG GAT GCC ACA CC 3´
M6b exón III antisentido
5´ AGT TAG CAG TCC CAT CTT CCC A 3´
Ciclofilina sentido
5’ AAG CAT ACA GGT CCT GGC ATC T 3’
Ciclofilina antisentido
5’ CAT TCA GTC TTG GCA GTG CAG 3’
G6PDH sentido
5’ TGA CCA ATT CCA TAC TCC ATG GT 3’
G6PDH antisentido
5’ ATT CTA GCT GCT GTG CTT GCC T 3’
Beta-actina sentido
5´ CAA CTT GAT GTA TGA AGG CTT TTG GT 3´
Beta-actina antisentido
5´ ACT TTT ATT GGT CTC AAG TCA GTG TAC AG 3´
Tabla 3. Oligonucleótidos utilizados para las mediciones de PCR en tiempo real. G6PDH: glucosa-6-fosfatodeshidrogenasa.
La detección directa de los productos de PCR se monitoreó midiendo el incremento
en la fluorescencia causada por la unión del colorante SYBR Green a ADN doble cadena,
como se describió previamente (Wittwer et al. 1997). Todas las cuantificaciones fueron
normalizadas utilizando como gen de referencia a la proteína ciclofilina, obteniéndose
esencialmente los mismos resultados al normalizar con el gen de referencia a la glucosa-6fosfato deshidrogenasa (G6PDH). Cada experimento de cuantificación de RT-PCR se realizó
por duplicado. Las medias de cada grupo fueron comparadas con el test T de Student, de 2
colas, para analizar si las diferencias eran significativas estadísticamente con el programa
Analyse-it® para Microsoft Excel. Para la cuantificación de la expresión relativa de distintas
isoformas, se utilizó la fórmula descripta por Plaffl (Pfaffl 2001).
85
Materiales y métodos
7.13 Análisis de polimorfismos en el gen GPM6A en pacientes con depresión
Se utilizaron muestras de ADN genómico de 28 pacientes (19 mujeres y 7 hombres)
diagnosticados con distintos tipos de depresión provistas por la Dra. Elena Jazín de la
Universidad de Uppsala, Suecia. Las muestras corresponden a 21 pacientes diagnosticados
con depresión mayor, 3 pacientes diagnósticos con desorden depresivo tipo NOS (del inglés,
Not Otherwise Specified), 2 pacientes con trastorno bipolar de tipo II, 1 paciente con
desorden esquizo-afectivo de tipo bipolar y 1 paciente con distimia.
Las regiones correspondientes a los exones del gen GPM6A y una región de 300pb
que flanquea el polimorfismo rs10520303 presente en el segundo intrón del gen fueron
amplificadas por PCR utilizando la enzima Taq DNA polimerasa de Invitrogen®. La tabla a
continuación muestra los oligonucleótidos utilizados y el tamaño de los amplicones
obtenidos.
Nombre
Secuencia
Exón 1 F
5´ATAGGGTTTTTCCTTCCAGT 3´
Exón 1 R
5´CCAAGAGAGAAACATTCATT 3´
Exon 2 F
5´TTGTATGGTTGACCTGGTAT 3´
Exón 2 R
5´CCCCTAATCATTTAACACAT 3´
Exón 3 F
5´AAAGAATCATGAGCATGTGA 3´
Exón 3 R
5´AGAAGGAAACGTTACTGTGT 3´
Exón 4 F
5´TATAATGGAGCTTTGCAGAT 3´
Exón 4 R
5´TAGAGGCAGCTATGTAGGTA 3´
Exón 5 F
5´AGATAAAATGGAACTTGCTT 3´
Exón 5 R
5´AATGAATGCTAAAATTCTGA 3´
Exón 6 F
5´CTCGCTTTTATTTAAGATGT 3´
Exón 6 R
5´TCTCTACAAGCAAATAGCTT 3´
Exón 7 CDS F
5´CGAAGACTTCTTTCGAGATA 3´
Exón 7 CDS R
5´TAATATGGCCACTGATCTTC 3´
Exón 7 UTR1 F
5´ATGACTCTTGAAATATGGAA 3´
Exón 7 UTR1 R
5´TTCCTTTGATACAGGTACTT 3´
Exón 7 UTR2 F
5´AAGTACCTGTATCAAAGGAA 3´
Exón 7 UTR2 R
5´CACACATAGGAAAGAGGAAT 3´
Intrón 2 rs10520303 F
5´GGATAAGAAGTTGCACACTTC 3´
Intrón 2 rs10320303 R
5´CATGTGGGAGCTGGCCTGA 3´
Tamaño del amplicón
1050 pb
385 pb
360 pb
309 pb
232 pb
242 pb
762 pb
739 pb
832 pb
300 pb
Tabla 4. Oligonucleótidos utilizados y tamaño de los amplicones obtenidos en la amplificación de los exones y
de una región intrónica conteniendo el polimorfismo rs10520303 del gen GPM6A humano.
86
Materiales y métodos
Los productos de PCR fueron secuenciados automáticamente con el secuenciador de
geles de poliacrilamida ABI 377 y el secuenciador de capilares ABI 3130 de Applied
Biosystem®. Cada producto de PCR fue secuenciado al menos 2 veces, secuenciándose tanto
la hebra sentido como la antisentido. Los cromatogramas obtenidos fueron luego analizados
con el programa Sequencher 4.7 de Gene Codes Corpotation para la identificación de
polimorfismos.
87
Referencias
8. REFERENCIAS
Aberg, M. A., N. D. Aberg, H. Hedbacker, J. Oscarsson and P. S. Eriksson (2000). "Peripheral
infusion of IGF-I selectively induces neurogenesis in the adult rat hippocampus." J
Neurosci 20 (8): 2896-903.
Acsady, L., A. Kamondi, A. Sik, T. Freund and G. Buzsaki (1998). "GABAergic cells are the
major postsynaptic targets of mossy fibers in the rat hippocampus." J Neurosci 18
(9): 3386-403.
Alfonso, J., F. Aguero, D. O. Sanchez, G. Flugge, E. Fuchs, A. C. Frasch and G. D. Pollevick
(2004). "Gene expression analysis in the hippocampal formation of tree shrews
chronically treated with cortisol." J Neurosci Res 78 (5): 702-10.
Alfonso, J., M. E. Fernandez, B. Cooper, G. Flugge and A. C. Frasch (2005). "The stressregulated protein M6a is a key modulator for neurite outgrowth and
filopodium/spine formation." Proc Natl Acad Sci U S A 102 (47): 17196-201.
Alfonso, J., A. C. Frasch and G. Flugge (2005). "Chronic stress, depression and
antidepressants: effects on gene transcription in the hippocampus." Rev Neurosci 16
(1): 43-56.
Alfonso, J., L. R. Frick, D. M. Silberman, M. L. Palumbo, A. M. Genaro and A. C. Frasch (2006).
"Regulation of hippocampal gene expression is conserved in two species subjected to
different stressors and antidepressant treatments." Biol Psychiatry 59 (3): 244-51.
Alfonso, J., G. D. Pollevick, M. G. Van Der Hart, G. Flugge, E. Fuchs and A. C. Frasch (2004).
"Identification of genes regulated by chronic psychosocial stress and antidepressant
treatment in the hippocampus." Eur J Neurosci 19 (3): 659-66.
Alvarez, V. A. and B. L. Sabatini (2007). "Anatomical and physiological plasticity of dendritic
spines." Annu Rev Neurosci 30: 79-97.
Allen, C. B., T. Celikel and D. E. Feldman (2003). "Long-term depression induced by sensory
deprivation during cortical map plasticity in vivo." Nat Neurosci 6 (3): 291-9.
Baron, P., J. Kamholz, S. Scherer, H. Honda, M. Shy, E. Scarpini, G. Scarlato and D. Pleasure
(1993). "Appearance of PLP mRNA in specific regions of the developing rat
lumbosacral spinal cord as revealed by in situ hybridization." Exp Neurol 121 (1):
139-47.
Bellivier, F., C. Henry, A. Szoke, F. Schurhoff, M. Nosten-Bertrand, J. Feingold, J. M. Launay,
M. Leboyer and J. L. Laplanche (1998). "Serotonin transporter gene polymorphisms in
patients with unipolar or bipolar depression." Neurosci Lett 255 (3): 143-6.
Berton, O. and E. J. Nestler (2006). "New approaches to antidepressant drug discovery:
beyond monoamines." Nat Rev Neurosci 7 (2): 137-51.
88
Referencias
Blackstad, T. W. and A. Kjaerheim (1961). "Special axo-dendritic synapses in the hippocampal
cortex: electron and light microscopic studies on the layer of mossy fibers." J Comp
Neurol 117: 133-59.
Boison, D., H. Bussow, D. D'Urso, H. W. Muller and W. Stoffel (1995). "Adhesive properties of
proteolipid protein are responsible for the compaction of CNS myelin sheaths." J
Neurosci 15 (8): 5502-13.
Boison, D. and W. Stoffel (1994). "Disruption of the compacted myelin sheath of axons of the
central nervous system in proteolipid protein-deficient mice." Proc Natl Acad Sci U S
A 91 (24): 11709-13.
Boks, M. P., M. Hoogendoorn, B. J. Jungerius, S. C. Bakker, I. E. Sommer, R. J. Sinke, R. A.
Ophoff and R. S. Kahn (2007). "Do mood symptoms subdivide the schizophrenia
phenotype? association of the GMP6A gene with a depression subgroup." Am J Med
Genet B Neuropsychiatr Genet.
Bremner, J. D., M. Narayan, E. R. Anderson, L. H. Staib, H. L. Miller and D. S. Charney (2000).
"Hippocampal volume reduction in major depression." Am J Psychiatry 157 (1): 1158.
Brown, J., C. M. Cooper-Kuhn, G. Kempermann, H. Van Praag, J. Winkler, F. H. Gage and H. G.
Kuhn (2003). "Enriched environment and physical activity stimulate hippocampal but
not olfactory bulb neurogenesis." Eur J Neurosci 17 (10): 2042-6.
Burmeister, M. (1999). "Basic concepts in the study of diseases with complex genetics." Biol
Psychiatry 45 (5): 522-32.
Butchbach, M. E., G. Tian, H. Guo and C. L. Lin (2004). "Association of excitatory amino acid
transporters, especially EAAT2, with cholesterol-rich lipid raft microdomains:
importance for excitatory amino acid transporter localization and function." J Biol
Chem 279 (33): 34388-96.
Calabrese, B., M. S. Wilson and S. Halpain (2006). "Development and regulation of dendritic
spine synapses." Physiology (Bethesda) 21: 38-47.
Cameron, H. A. and E. Gould (1994). "Adult neurogenesis is regulated by adrenal steroids in
the dentate gyrus." Neuroscience 61 (2): 203-9.
Campagnoni, C. W., B. Garbay, P. Micevych, T. Pribyl, K. Kampf, V. W. Handley and A. T.
Campagnoni (1992). "DM20 mRNA splice product of the myelin proteolipid protein
gene is expressed in the murine heart." J Neurosci Res 33 (1): 148-55.
Canton, D. A. and D. W. Litchfield (2006). "The shape of things to come: an emerging role for
protein kinase CK2 in the regulation of cell morphology and the cytoskeleton." Cell
Signal 18 (3): 267-75.
Carleton, A., L. T. Petreanu, R. Lansford, A. Alvarez-Buylla and P. M. Lledo (2003). "Becoming
a new neuron in the adult olfactory bulb." Nat Neurosci 6 (5): 507-18.
89
Referencias
Citri, A. and R. C. Malenka (2008). "Synaptic plasticity: multiple forms, functions, and
mechanisms." Neuropsychopharmacology 33 (1): 18-41.
Cooper, B., H. B. Werner and G. Flugge (2008). "Glycoprotein M6a is present in glutamatergic
axons in adult rat forebrain and cerebellum." Brain Res 1197: 1-12.
Czeh, B., T. Michaelis, T. Watanabe, J. Frahm, G. de Biurrun, M. van Kampen, A. Bartolomucci
and E. Fuchs (2001). "Stress-induced changes in cerebral metabolites, hippocampal
volume, and cell proliferation are prevented by antidepressant treatment with
tianeptine." Proc Natl Acad Sci U S A 98 (22): 12796-801.
Chan, J. P., J. Cordeira, G. A. Calderon, L. K. Iyer and M. Rios (2008). "Depletion of central
BDNF in mice impedes terminal differentiation of new granule neurons in the adult
hippocampus." Mol Cell Neurosci.
de Kloet, E. R., M. Joels and F. Holsboer (2005). "Stress and the brain: from adaptation to
disease." Nat Rev Neurosci 6 (6): 463-75.
De Kloet, E. R., E. Vreugdenhil, M. S. Oitzl and M. Joels (1998). "Brain corticosteroid receptor
balance in health and disease." Endocr Rev 19 (3): 269-301.
DeGiorgis, J. A., H. Jaffe, J. E. Moreira, C. G. Carlotti, Jr., J. P. Leite, H. C. Pant and A. Dosemeci
(2005). "Phosphoproteomic analysis of synaptosomes from human cerebral cortex." J
Proteome Res 4 (2): 306-15.
Dent, E. W., A. V. Kwiatkowski, L. M. Mebane, U. Philippar, M. Barzik, D. A. Rubinson, S.
Gupton, J. E. Van Veen, C. Furman, J. Zhang, A. S. Alberts, S. Mori and F. B. Gertler
(2007). "Filopodia are required for cortical neurite initiation." Nat Cell Biol 9 (12):
1347-59.
Dotti, C. G., C. A. Sullivan and G. A. Banker (1988). "The establishment of polarity by
hippocampal neurons in culture." J Neurosci 8 (4): 1454-68.
Duman, R. S. (2004). "Role of neurotrophic factors in the etiology and treatment of mood
disorders." Neuromolecular Med 5 (1): 11-25.
Duman, R. S., G. R. Heninger and E. J. Nestler (1997). "A molecular and cellular theory of
depression." Arch Gen Psychiatry 54 (7): 597-606.
Dunaevsky, A. and C. A. Mason (2003). "Spine motility: a means towards an end?" Trends
Neurosci 26 (3): 155-60.
Duncan, I. D., J. P. Hammang and B. D. Trapp (1987). "Abnormal compact myelin in the
myelin-deficient rat: absence of proteolipid protein correlates with a defect in the
intraperiod line." Proc Natl Acad Sci U S A 84 (17): 6287-91.
Fava, M. and K. S. Kendler (2000). "Major depressive disorder." Neuron 28 (2): 335-41.
Fiala, J. C., M. Feinberg, V. Popov and K. M. Harris (1998). "Synaptogenesis via dendritic
filopodia in developing hippocampal area CA1." J Neurosci 18 (21): 8900-11.
90
Referencias
Fletcher, T. L., P. Cameron, P. De Camilli and G. Banker (1991). "The distribution of synapsin I
and synaptophysin in hippocampal neurons developing in culture." J Neurosci 11 (6):
1617-26.
Folch, J., I. Ascoli, M. Lees, J. A. Meath and B. N. Le (1951). "Preparation of lipide extracts
from brain tissue." J Biol Chem 191 (2): 833-41.
Frotscher, M., P. Jonas and R. S. Sloviter (2006). "Synapses formed by normal and abnormal
hippocampal mossy fibers." Cell Tissue Res 326 (2): 361-7.
Fuchs, E., B. Czeh, M. H. Kole, T. Michaelis and P. J. Lucassen (2004). "Alterations of
neuroplasticity in depression: the hippocampus and beyond." Eur
Neuropsychopharmacol 14 Suppl 5: S481-90.
Gage, F. H. (2000). "Mammalian neural stem cells." Science 287 (5457): 1433-8.
Gage, F. H. (2004). "Structural plasticity of the adult brain." Dialogues Clin Neurosci 6 (2):
135-41.
Goda, Y. and G. W. Davis (2003). "Mechanisms of synapse assembly and disassembly."
Neuron 40 (2): 243-64.
Gogolla, N., I. Galimberti and P. Caroni (2007). "Structural plasticity of axon terminals in the
adult." Curr Opin Neurobiol 17 (5): 516-24.
Gould, E., B. S. McEwen, P. Tanapat, L. A. Galea and E. Fuchs (1997). "Neurogenesis in the
dentate gyrus of the adult tree shrew is regulated by psychosocial stress and NMDA
receptor activation." J Neurosci 17 (7): 2492-8.
Gudz, T. I., T. E. Schneider, T. A. Haas and W. B. Macklin (2002). "Myelin proteolipid protein
forms a complex with integrins and may participate in integrin receptor signaling in
oligodendrocytes." J Neurosci 22 (17): 7398-407.
Hall, A. (1998). "Rho GTPases and the actin cytoskeleton." Science 279 (5350): 509-14.
Harms, K. J. and A. Dunaevsky (2007). "Dendritic spine plasticity: looking beyond
development." Brain Res 1184: 65-71.
Heine, V. M., S. Maslam, J. Zareno, M. Joels and P. J. Lucassen (2004). "Suppressed
proliferation and apoptotic changes in the rat dentate gyrus after acute and chronic
stress are reversible." Eur J Neurosci 19 (1): 131-44.
Hemler, M. E. (2005). "Tetraspanin functions and associated microdomains." Nat Rev Mol
Cell Biol 6 (10): 801-11.
Holsboer, F. (2000). "The corticosteroid receptor
Neuropsychopharmacology 23 (5): 477-501.
hypothesis
of
depression."
Holsboer, F. (2001). "Stress, hypercortisolism and corticosteroid receptors in depression:
implications for therapy." J Affect Disord 62 (1-2): 77-91.
91
Referencias
Holsboer, F. and N. Barden (1996). "Antidepressants and hypothalamic-pituitaryadrenocortical regulation." Endocr Rev 17 (2): 187-205.
Holtmaat, A. J., J. T. Trachtenberg, L. Wilbrecht, G. M. Shepherd, X. Zhang, G. W. Knott and K.
Svoboda (2005). "Transient and persistent dendritic spines in the neocortex in vivo."
Neuron 45 (2): 279-91.
Hu, Y. and S. J. Russek (2008). "BDNF and the diseased nervous system: a delicate balance
between adaptive and pathological processes of gene regulation." J Neurochem 105
(1): 1-17.
Iga, J., S. Ueno, K. Yamauchi, S. Numata, S. Tayoshi-Shibuya, S. Kinouchi, M. Nakataki, H.
Song, K. Hokoishi, H. Tanabe, A. Sano and T. Ohmori (2007). "The Val66Met
polymorphism of the brain-derived neurotrophic factor gene is associated with
psychotic feature and suicidal behavior in Japanese major depressive patients." Am J
Med Genet B Neuropsychiatr Genet 144B (8): 1003-6.
Ikenaka, K., T. Kagawa and K. Mikoshiba (1992). "Selective expression of DM-20, an
alternatively spliced myelin proteolipid protein gene product, in developing nervous
system and in nonglial cells." J Neurochem 58 (6): 2248-53.
Jacobs, B. L., H. Praag and F. H. Gage (2000). "Adult brain neurogenesis and psychiatry: a
novel theory of depression." Mol Psychiatry 5 (3): 262-9.
Kendler, K. S., L. M. Karkowski and C. A. Prescott (1999). "Causal relationship between
stressful life events and the onset of major depression." Am J Psychiatry 156 (6):
837-41.
Kennedy, M. B., H. C. Beale, H. J. Carlisle and L. R. Washburn (2005). "Integration of
biochemical signalling in spines." Nat Rev Neurosci 6 (6): 423-34.
Kessler, R. C. (1997). "The effects of stressful life events on depression." Annu Rev Psychol
48: 191-214.
Kim, J. J. and D. M. Diamond (2002). "The stressed hippocampus, synaptic plasticity and lost
memories." Nat Rev Neurosci 3 (6): 453-62.
Klann, E., M. D. Antion, J. L. Banko and L. Hou (2004). "Synaptic plasticity and translation
initiation." Learn Mem 11 (4): 365-72.
Knapp, P. E. (1996). "Proteolipid protein: is it more than just a structural component of
myelin?" Dev Neurosci 18 (4): 297-308.
Kunugi, H., R. Hashimoto, M. Yoshida, M. Tatsumi and K. Kamijima (2004). "A missense
polymorphism (S205L) of the low-affinity neurotrophin receptor p75NTR gene is
associated with depressive disorder and attempted suicide." Am J Med Genet B
Neuropsychiatr Genet 129B (1): 44-6.
Kwiatkowski, A. V., D. A. Rubinson, E. W. Dent, J. Edward van Veen, J. D. Leslie, J. Zhang, L.
M. Mebane, U. Philippar, E. M. Pinheiro, A. A. Burds, R. T. Bronson, S. Mori, R. Fassler
92
Referencias
and F. B. Gertler (2007). "Ena/VASP Is Required for neuritogenesis in the developing
cortex." Neuron 56 (3): 441-55.
Lagenaur, C., V. Kunemund, G. Fischer, S. Fushiki and M. Schachner (1992). "Monoclonal M6
antibody interferes with neurite extension of cultured neurons." J Neurobiol 23 (1):
71-88.
Lau, P. M., R. S. Zucker and D. Bentley (1999). "Induction of filopodia by direct local elevation
of intracellular calcium ion concentration." J Cell Biol 145 (6): 1265-75.
Lesch, K. P. (2004). "Gene-environment interaction and the genetics of depression." J
Psychiatry Neurosci 29 (3): 174-84.
Liang, Y. J., D. F. Wu, R. Stumm, V. Hollt and T. Koch (2008). "Membrane glycoprotein M6A
promotes mu-opioid receptor endocytosis and facilitates receptor sorting into the
recycling pathway." Cell Res 18 (7): 768-79.
Lim, D. A., A. D. Tramontin, J. M. Trevejo, D. G. Herrera, J. M. Garcia-Verdugo and A. AlvarezBuylla (2000). Noggin antagonizes BMP signaling to create a niche for adult
neurogenesis. Neuron. 28: 713-26.
Luo, L. (2000). "Rho GTPases in neuronal morphogenesis." Nat Rev Neurosci 1 (3): 173-80.
Luo, L. (2002). "Actin cytoskeleton regulation in neuronal morphogenesis and structural
plasticity." Annu Rev Cell Dev Biol 18: 601-35.
MacQueen, G. M., S. Campbell, B. S. McEwen, K. Macdonald, S. Amano, R. T. Joffe, C.
Nahmias and L. T. Young (2003). "Course of illness, hippocampal function, and
hippocampal volume in major depression." Proc Natl Acad Sci U S A 100 (3): 1387-92.
Magarinos, A. M., A. Deslandes and B. S. McEwen (1999). "Effects of antidepressants and
benzodiazepine treatments on the dendritic structure of CA3 pyramidal neurons after
chronic stress." Eur J Pharmacol 371 (2-3): 113-22.
Magarinos, A. M. and B. S. McEwen (1995). "Stress-induced atrophy of apical dendrites of
hippocampal CA3c neurons: comparison of stressors." Neuroscience 69 (1): 83-8.
Magarinos, A. M. and B. S. McEwen (1995). "Stress-induced atrophy of apical dendrites of
hippocampal CA3c neurons: involvement of glucocorticoid secretion and excitatory
amino acid receptors." Neuroscience 69 (1): 89-98.
Magarinos, A. M., B. S. McEwen, G. Flugge and E. Fuchs (1996). "Chronic psychosocial stress
causes apical dendritic atrophy of hippocampal CA3 pyramidal neurons in
subordinate tree shrews." J Neurosci 16 (10): 3534-40.
Magarinos, A. M., J. M. Verdugo and B. S. McEwen (1997). "Chronic stress alters synaptic
terminal structure in hippocampus." Proc Natl Acad Sci U S A 94 (25): 14002-8.
93
Referencias
Malberg, J. E., A. J. Eisch, E. J. Nestler and R. S. Duman (2000). "Chronic antidepressant
treatment increases neurogenesis in adult rat hippocampus." J Neurosci 20 (24):
9104-10.
Manev, H., T. Uz, N. R. Smalheiser and R. Manev (2001). "Antidepressants alter cell
proliferation in the adult brain in vivo and in neural cultures in vitro." Eur J Pharmacol
411 (1-2): 67-70.
Manji, H. K. and R. S. Duman (2001). "Impairments of neuroplasticity and cellular resilience
in severe mood disorders: implications for the development of novel therapeutics."
Psychopharmacol Bull 35 (2): 5-49.
Manns, J. R. and H. Eichenbaum (2006). "Evolution of declarative memory." Hippocampus
16 (9): 795-808.
McClung, C. A. and E. J. Nestler (2008). "Neuroplasticity mediated by altered gene
expression." Neuropsychopharmacology 33 (1): 3-17.
McEwen, B. S. (2004). "Structural plasticity of the adult brain: how animal models help us
understand brain changes in depression and systemic disorders related to
depression." Dialogues Clin Neurosci 6 (2): 119-33.
Mervaala, E., J. Fohr, M. Kononen, M. Valkonen-Korhonen, P. Vainio, K. Partanen, J.
Partanen, J. Tiihonen, H. Viinamaki, A. K. Karjalainen and J. Lehtonen (2000).
"Quantitative MRI of the hippocampus and amygdala in severe depression." Psychol
Med 30 (1): 117-25.
Michibata, H., T. Okuno, N. Konishi, K. Wakimoto, K. Kyono, K. Aoki, Y. Kondo, K. Takata, Y.
Kitamura and T. Taniguchi (2008). "Inhibition of Mouse GPM6A Expression Leads to
Decreased Differentiation of Neurons Derived from Mouse Embryonic Stem Cells."
Stem Cells Dev.
Mukobata, S., T. Hibino, A. Sugiyama, Y. Urano, A. Inatomi, Y. Kanai, H. Endo and F. Tashiro
(2002). "M6a acts as a nerve growth factor-gated Ca(2+) channel in neuronal
differentiation." Biochem Biophys Res Commun 297 (4): 722-8.
Nadon, N. L., S. Miller, K. Draeger and M. Salvaggio (1997). "Myelin proteolipid DM20:
evidence for function independent of myelination." Int J Dev Neurosci 15 (3): 285-93.
Nadon, N. L. and M. West (1998). "Myelin proteolipid protein: function in myelin structure is
distinct from its role in oligodendrocyte development." Dev Neurosci 20 (6): 533-9.
Nakayama, A. Y. and L. Luo (2000). "Intracellular signaling pathways that regulate dendritic
spine morphogenesis." Hippocampus 10 (5): 582-6.
Nestler, E. J., M. Barrot, R. J. DiLeone, A. J. Eisch, S. J. Gold and L. M. Monteggia (2002).
"Neurobiology of depression." Neuron 34 (1): 13-25.
Newey, S. E., V. Velamoor, E. E. Govek and L. Van Aelst (2005). "Rho GTPases, dendritic
structure, and mental retardation." J Neurobiol 64 (1): 58-74.
94
Referencias
Nikonenko, I., P. Jourdain, S. Alberi, N. Toni and D. Muller (2002). "Activity-induced changes
of spine morphology." Hippocampus 12 (5): 585-91.
Ohl, F., T. Michaelis, G. K. Vollmann-Honsdorf, C. Kirschbaum and E. Fuchs (2000). "Effect of
chronic psychosocial stress and long-term cortisol treatment on hippocampusmediated memory and hippocampal volume: a pilot-study in tree shrews."
Psychoneuroendocrinology 25 (4): 357-63.
Osterweil, E., D. G. Wells and M. S. Mooseker (2005). "A role for myosin VI in postsynaptic
structure and glutamate receptor endocytosis." J Cell Biol 168 (2): 329-38.
Owens, M. J. (2004). "Selectivity of antidepressants: from the monoamine hypothesis of
depression to the SSRI revolution and beyond." J Clin Psychiatry 65 Suppl 4: 5-10.
Pastalkova, E., P. Serrano, D. Pinkhasova, E. Wallace, A. A. Fenton and T. C. Sacktor (2006).
"Storage of spatial information by the maintenance mechanism of LTP." Science 313
(5790): 1141-4.
Paykel, E. S. (2001). "Stress and affective disorders in humans." Semin Clin Neuropsychiatry
6 (1): 4-11.
Penzes, P., A. Beeser, J. Chernoff, M. R. Schiller, B. A. Eipper, R. E. Mains and R. L. Huganir
(2003). "Rapid induction of dendritic spine morphogenesis by trans-synaptic ephrinBEphB receptor activation of the Rho-GEF kalirin." Neuron 37 (2): 263-74.
Pfaffl, M. W. (2001). "A new mathematical model for relative quantification in real-time RTPCR." Nucleic Acids Res 29 (9): e45.
Pham, K., J. Nacher, P. R. Hof and B. S. McEwen (2003). "Repeated restraint stress
suppresses neurogenesis and induces biphasic PSA-NCAM expression in the adult rat
dentate gyrus." Eur J Neurosci 17 (4): 879-86.
Popot, J. L., D. Pham Dinh and A. Dautigny (1991). "Major myelin proteolipid: the 4-alphahelix topology." J Membr Biol 123 (3): 278.
Ridley, A. J. (2006). "Rho GTPases and actin dynamics in membrane protrusions and vesicle
trafficking." Trends Cell Biol 16 (10): 522-9.
Ririe, K. M., R. P. Rasmussen and C. T. Wittwer (1997). "Product differentiation by analysis of
DNA melting curves during the polymerase chain reaction." Anal Biochem 245 (2):
154-60.
Rodriguez, J. J., M. F. Montaron, K. G. Petry, C. Aurousseau, M. Marinelli, S. Premier, G.
Rougon, M. Le Moal and D. N. Abrous (1998). "Complex regulation of the expression
of the polysialylated form of the neuronal cell adhesion molecule by glucocorticoids
in the rat hippocampus." Eur J Neurosci 10 (9): 2994-3006.
Ryan, X. P., J. Alldritt, P. Svenningsson, P. B. Allen, G. Y. Wu, A. C. Nairn and P. Greengard
(2005). "The Rho-specific GEF Lfc interacts with neurabin and spinophilin to regulate
dendritic spine morphology." Neuron 47 (1): 85-100.
95
Referencias
Sandi, C., H. A. Davies, M. I. Cordero, J. J. Rodriguez, V. I. Popov and M. G. Stewart (2003).
"Rapid reversal of stress induced loss of synapses in CA3 of rat hippocampus
following water maze training." Eur J Neurosci 17 (11): 2447-56.
Santarelli, L., M. Saxe, C. Gross, A. Surget, F. Battaglia, S. Dulawa, N. Weisstaub, J. Lee, R.
Duman, O. Arancio, C. Belzung and R. Hen (2003). "Requirement of hippocampal
neurogenesis for the behavioral effects of antidepressants." Science 301 (5634): 8059.
Sapolsky, R. M., L. M. Romero and A. U. Munck (2000). "How do glucocorticoids influence
stress responses? Integrating permissive, suppressive, stimulatory, and preparative
actions." Endocr Rev 21 (1): 55-89.
Sarchiapone, M., V. Carli, A. Roy, L. Iacoviello, C. Cuomo, M. C. Latella, M. di Giannantonio, L.
Janiri, M. de Gaetano and M. N. Janal (2008). "Association of Polymorphism
(Val66Met) of Brain-Derived Neurotrophic Factor with Suicide Attempts in Depressed
Patients." Neuropsychobiology 57 (3): 139-145.
Schneider, A., H. Lander, G. Schulz, H. Wolburg, K. A. Nave, J. B. Schulz and M. Simons (2005).
"Palmitoylation is a sorting determinant for transport to the myelin membrane." J
Cell Sci 118 (Pt 11): 2415-23.
Schweitzer, J., T. Becker, M. Schachner, K. A. Nave and H. Werner (2006). "Evolution of
myelin proteolipid proteins: gene duplication in teleosts and expression pattern
divergence." Mol Cell Neurosci 31 (1): 161-77.
Sheline, Y. I., M. H. Gado and H. C. Kraemer (2003). "Untreated depression and hippocampal
volume loss." Am J Psychiatry 160 (8): 1516-8.
Sheline, Y. I., M. Sanghavi, M. A. Mintun and M. H. Gado (1999). "Depression duration but
not age predicts hippocampal volume loss in medically healthy women with
recurrent major depression." J Neurosci 19 (12): 5034-43.
Simons, K. and E. Ikonen (1997). "Functional rafts in cell membranes." Nature 387 (6633):
569-72.
Simons, K. and D. Toomre (2000). "Lipid rafts and signal transduction." Nat Rev Mol Cell Biol
1 (1): 31-9.
Simons, M., E. M. Kramer, P. Macchi, S. Rathke-Hartlieb, J. Trotter, K. A. Nave and J. B. Schulz
(2002). "Overexpression of the myelin proteolipid protein leads to accumulation of
cholesterol and proteolipid protein in endosomes/lysosomes: implications for
Pelizaeus-Merzbacher disease." J Cell Biol 157 (2): 327-36.
Simons, M., E. M. Kramer, C. Thiele, W. Stoffel and J. Trotter (2000). "Assembly of myelin by
association of proteolipid protein with cholesterol- and galactosylceramide-rich
membrane domains." J Cell Biol 151 (1): 143-54.
96
Referencias
Smith, M. A., S. Makino, R. Kvetnansky and R. M. Post (1995). "Stress and glucocorticoids
affect the expression of brain-derived neurotrophic factor and neurotrophin-3
mRNAs in the hippocampus." J Neurosci 15 (3 Pt 1): 1768-77.
Smith, S. M. and W. W. Vale (2006). "The role of the hypothalamic-pituitary-adrenal axis in
neuroendocrine responses to stress." Dialogues Clin Neurosci 8 (4): 383-95.
Sorrells, S. F. and R. M. Sapolsky (2007). "An inflammatory review of glucocorticoid actions in
the CNS." Brain Behav Immun 21 (3): 259-72.
Sousa, N., N. V. Lukoyanov, M. D. Madeira, O. F. Almeida and M. M. Paula-Barbosa (2000).
"Reorganization of the morphology of hippocampal neurites and synapses after
stress-induced damage correlates with behavioral improvement." Neuroscience 97
(2): 253-66.
Stewart, M. G., H. A. Davies, C. Sandi, I. V. Kraev, V. V. Rogachevsky, C. J. Peddie, J. J.
Rodriguez, M. I. Cordero, H. S. Donohue, P. L. Gabbott and V. I. Popov (2005). "Stress
suppresses and learning induces plasticity in CA3 of rat hippocampus: a threedimensional ultrastructural study of thorny excrescences and their postsynaptic
densities." Neuroscience 131 (1): 43-54.
Stipp, C. S., T. V. Kolesnikova and M. E. Hemler (2003). "Functional domains in tetraspanin
proteins." Trends Biochem Sci 28 (2): 106-12.
Tadokoro, K., R. Hashimoto, M. Tatsumi, A. Kosuga, K. Kamijima and H. Kunugi (2005). "The
Gem interacting protein (GMIP) gene is associated with major depressive disorder."
Neurogenetics 6 (3): 127-33.
Takagishi, Y., S. Oda, S. Hayasaka, K. Dekker-Ohno, T. Shikata, M. Inouye and H. Yamamura
(1996). "The dilute-lethal (dl) gene attacks a Ca2+ store in the dendritic spine of
Purkinje cells in mice." Neurosci Lett 215 (3): 169-72.
Thomson, C. E., P. Montague, M. Jung, K. A. Nave and I. R. Griffiths (1997). "Phenotypic
severity of murine Plp mutants reflects in vivo and in vitro variations in transport of
PLP isoproteins." Glia 20 (4): 322-32.
Timsit, S. G., L. Bally-Cuif, D. R. Colman and B. Zalc (1992). "DM-20 mRNA is expressed during
the embryonic development of the nervous system of the mouse." J Neurochem 58
(3): 1172-5.
Trachtenberg, J. T., B. E. Chen, G. W. Knott, G. Feng, J. R. Sanes, E. Welker and K. Svoboda
(2002). "Long-term in vivo imaging of experience-dependent synaptic plasticity in
adult cortex." Nature 420 (6917): 788-94.
Trapp, B. D., A. Nishiyama, D. Cheng and W. Macklin (1997). "Differentiation and death of
premyelinating oligodendrocytes in developing rodent brain." J Cell Biol 137 (2): 45968.
97
Referencias
van Kampen, M., M. Kramer, C. Hiemke, G. Flugge and E. Fuchs (2002). "The chronic
psychosocial stress paradigm in male tree shrews: evaluation of a novel animal model
for depressive disorders." Stress 5 (1): 37-46.
van Praag, H., G. Kempermann and F. H. Gage (1999). "Running increases cell proliferation
and neurogenesis in the adult mouse dentate gyrus." Nat Neurosci 2 (3): 266-70.
van Praag, H., A. F. Schinder, B. R. Christie, N. Toni, T. D. Palmer and F. H. Gage (2002).
"Functional neurogenesis in the adult hippocampus." Nature 415 (6875): 1030-4.
van West, D., F. Van Den Eede, J. Del-Favero, D. Souery, K. F. Norrback, C. Van Duijn, S. Sluijs,
R. Adolfsson, J. Mendlewicz, D. Deboutte, C. Van Broeckhoven and S. Claes (2006).
"Glucocorticoid receptor gene-based SNP analysis in patients with recurrent major
depression." Neuropsychopharmacology 31 (3): 620-7.
Verity, A. N. and A. T. Campagnoni (1988). "Regional expression of myelin protein genes in
the developing mouse brain: in situ hybridization studies." J Neurosci Res 21 (2-4):
238-48.
Vreugdenhil, E., E. R. de Kloet, M. Schaaf and N. A. Datson (2001). "Genetic dissection of
corticosterone
receptor
function
in
the
rat
hippocampus."
Eur
Neuropsychopharmacol 11 (6): 423-30.
Watanabe, Y., E. Gould, H. A. Cameron, D. C. Daniels and B. S. McEwen (1992). "Phenytoin
prevents stress- and corticosterone-induced atrophy of CA3 pyramidal neurons."
Hippocampus 2 (4): 431-5.
Watanabe, Y., E. Gould, D. C. Daniels, H. Cameron and B. S. McEwen (1992). "Tianeptine
attenuates stress-induced morphological changes in the hippocampus." Eur J
Pharmacol 222 (1): 157-62.
Watanabe, Y., E. Gould and B. S. McEwen (1992). "Stress induces atrophy of apical dendrites
of hippocampal CA3 pyramidal neurons." Brain Res 588 (2): 341-5.
Werner, H., L. Dimou, M. Klugmann, S. Pfeiffer and K. A. Nave (2001). "Multiple splice
isoforms of proteolipid M6B in neurons and oligodendrocytes." Mol Cell Neurosci 18
(6): 593-605.
Whitlock, J. R., A. J. Heynen, M. G. Shuler and M. F. Bear (2006). "Learning induces long-term
potentiation in the hippocampus." Science 313 (5790): 1093-7.
Wittwer, C. T., M. G. Herrmann, A. A. Moss and R. P. Rasmussen (1997). "Continuous
fluorescence monitoring of rapid cycle DNA amplification." Biotechniques 22 (1):
130-1, 134-8.
Woolley, C. S., E. Gould and B. S. McEwen (1990). "Exposure to excess glucocorticoids alters
dendritic morphology of adult hippocampal pyramidal neurons." Brain Res 531 (1-2):
225-31.
98
Referencias
Wu, D. F., T. Koch, Y. J. Liang, R. Stumm, S. Schulz, H. Schroder and V. Hollt (2007).
"Membrane glycoprotein M6a interacts with the micro-opioid receptor and facilitates
receptor endocytosis and recycling." J Biol Chem 282 (30): 22239-47.
Yan, Y., C. Lagenaur and V. Narayanan (1993). "Molecular cloning of M6: identification of a
PLP/DM20 gene family." Neuron 11 (3): 423-31.
Yan, Y., V. Narayanan and C. Lagenaur (1996). "Expression of members of the proteolipid
protein gene family in the developing murine central nervous system." J Comp
Neurol 370 (4): 465-78.
Yang, X. and R. P. Skoff (1997). "Proteolipid protein regulates the survival and differentiation
of oligodendrocytes." J Neurosci 17 (6): 2056-70.
Yu, W. P., E. J. Collarini, N. P. Pringle and W. D. Richardson (1994). "Embryonic expression of
myelin genes: evidence for a focal source of oligodendrocyte precursors in the
ventricular zone of the neural tube." Neuron 12 (6): 1353-62.
Zhang, W. and D. L. Benson (2001). "Stages of synapse development defined by dependence
on F-actin." J Neurosci 21 (14): 5169-81.
Zhao, J., A. Iida, Y. Ouchi, S. Satoh and S. Watanabe (2008). "M6a is expressed in the murine
neural retina and regulates neurite extension." Mol Vis 14: 1623-30.
Zito, K., G. Knott, G. M. Shepherd, S. Shenolikar and K. Svoboda (2004). "Induction of spine
growth and synapse formation by regulation of the spine actin cytoskeleton." Neuron
44 (2): 321-34.
Ziv, N. E. and S. J. Smith (1996). "Evidence for a role of dendritic filopodia in synaptogenesis
and spine formation." Neuron 17 (1): 91-102.
Zuo, Y., A. Lin, P. Chang and W. B. Gan (2005). "Development of long-term dendritic spine
stability in diverse regions of cerebral cortex." Neuron 46 (2): 181-9.
99
Agradecimientos
AGRADECIMIENTOS
•
A Carlos, por haberme permitido hacer el doctorado en su laboratorio, por haberme
guiado pero al mismo tiempo dado libertad para trabajar y por intentar levantarme el
ánimo cuando las cosas no salían.
•
A Juan, por haberme recomendado que siguiera este camino y por acompañarme
durante todo el recorrido.
•
A Juli, quien me ensenó a trabajar en la mesada, pero principalmente por su actitud
siempre positiva.
•
A Marce quien me acompañió durante todo el doctorado guiándome en todos los
sentidos.
•
A las que ya partieron dejando un vacío en el laboratorio: a Geo por todo lo compartido,
a Adri por las charlas y a Vani por lo vivido incluyendo las horas de docencia.
•
A Paulita, por su companñía hasta tardes horas en el lab.
•
A Beatus, por compartir conmigo su cultura.
•
A Cami, por estar siempre dispuesta a dar una mano y por cuidarme.
•
A Fla, por su preocupacion y buena onda.
•
A los chicos del lab 3: a Lau y a Gri por las charlas y Ale y Javier por ayudarme cada vez
que los hinché con algo.
•
A Su, Marilén y Adrián, por la buena onda y por los viernes dulces.
•
A Oscar, por matarme las ratas.
•
A los Campetella: a Juancito por compartir sus conocimientos cada vez que lo consulté y
a Valen, Vir y Romi por la buena onda.
•
A Fer, por las secuencias, el paddle y las extrañas charlas.
•
A Carlos Arregui por su buena predisposición siempre que acudí por algún motivo.
•
A Mariana, por todas las charlas y las horas compartidas en cultivo.
•
A Mirna, por ayudarme cada vez que le pedí algo y con la major predisposición.
•
A Ernesto, por su ayuda para conseguir todo el material de trabajo y su buena onda.
•
A Nelly y a Tere, por llenarnos las cajitas con tips, por autoclavarme todo lo que necesite
y por sacarme más de una sonrisa.
•
A Pablo, por su ayuda con la informática.
•
A Zulma, por ayudarme a mantener el orden y por la buena onda.
100
Agradecimientos
•
A todos los del IIB que me ayudaron de una u otra forma.
•
A Elena Jazín y a Karolina Aberg, por las muestras y el análisis de polimorfismos.
•
A Ana de Genaro y a Luciana Frick, por las muestras de ARNm de animales estresados.
•
A Marce, Cami, Pao y Juan por ayudarme con la corrección de la tesis.
•
A los jurados, por aceptar ser parte de esta tesis.
•
Al CONICET y a la UNSAM por las becas otorgadas para realizar mi trabajo de
investigación.
•
A Mati, por todos los papers que me mandó.
•
A Mary, mi amiguita de la Facu.
•
A Calu, por estar siempre.
•
Y a mi mamá, por su apoyo, por los viajes y por todos los momentos compatidos.
101