Download Detección por –PCR MULTIPLEX- de los transcritos

Document related concepts

Cromosoma Filadelfia wikipedia, lookup

Inhibidor de la tirosina quinasa wikipedia, lookup

Leucemia mieloide crónica wikipedia, lookup

Imatinib wikipedia, lookup

Leucemia mieloide aguda wikipedia, lookup

Transcript
CONSEJO NACIONAL DE CIENCIA Y TECNOLOGIA -CONCYTSECRETARIA NACIONAL DE CIENCIA Y TECNOLOGIA -SENACYTFONDO NACIONAL DE CIENCIA Y TECNOLOGIA -FONACYTFUNDACIÓN ROZAS-BOTRÁN- INSTITUTO DE INVESTIGACIÓN EN
ENFERMEDADES GENÉTICAS Y METABÓLICAS –INVEGEM-
INFORME FINAL
Detección por –PCR MULTIPLEX- de los transcritos quiméricos
BCR-ABL, E2A-PBX1, MLL-AF4, ETV6-AML1; y su utilidad como
factor pronóstico en pacientes pediátricos con Leucemia Linfoblástica
Aguda
PROYECTO FODECYT No. 48-2009
Dra. Claudia Carranza
Investigador Principal
GUATEMALA, NOVIEMBRE DEL 2011
AGRADECIMIENTOS:
La realización de este trabajo, ha sido posible gracias al apoyo financiero dentro del Fondo
Nacional de Ciencia y Tecnología, -FONACYT-, otorgado por la Secretaria Nacional de
Ciencia y Tecnología –SENACYT- y al Consejo Nacional de Ciencia y Tecnología –
CONCYT- .
RESUMEN
El objetivo general del proyecto Fodecyt 48-2009 es detectar los transcritos
de fusión BCR-ABL, E2A-PBX1, MLL-AF4. ETV6-AML1 mediante PCR
MULTIPLEX y determinar su utilidad en el establecimiento de un pronóstico.
Se obtuvieron células mononucleares de muestras de médula ósea de 143
pacientes con diagnóstico de leucemia linfoblástica aguda, mediante el uso de ficoll.
Se realizó la extracción de ARN y la retrotranscripción. Posteriormente se evalúo la
calidad del cDNA amplificando el gen control ABL y por último se evalúo la
presencia de los cuatro transcritos mediante PCR multiplex.
Se ha encontrado diez pacientes positivos para distintos transcritos de BCRABL, que corresponde a un 7%, el cual
concuerda con lo reportado
internacionalmente. Y seis pacientes positivos ( 4.5%) para ETV6-AML1, que es un
marcador de buen pronóstico, esta incidencia es bastante baja ya que en países
desarrollados se reporta hasta un 20% de positividad. Y tres pacientes positivos
(2%) para el transcrito E2A-PBX1.
La presencia de BCR-ABL en leucemia linfoblástica aguda indica muy mal
pronóstico, por lo que se ha procedido a informar inmediatamente a los médicos
tratantes; así mismo se ha informado de que en estos pacientes es necesario utilizar
esquemas de quimioterapias más agresivas, y de ser posible en combinación con
Imatinib y transplante de médula ósea. La presencia de E2A-PBX1, también es un
marcador de mal pronóstico, y que orienta a esquemas de quimioterapia más
agresivas. Y por último la presencia de ETV6-AML1 es indica buen pronóstico.
La baja incidencia del gen ETV6-AML1 encontrada en Guatemala, coincide
con países como España e India, con los cuales la población guatemalteca comparte
mayor cantidad de polimorfismos genéticos.
En los datos demográficos, la mayoría de pacientes analizados proceden del
occidente y centro de Guatemala; por lo que en un futuro proyecto se evaluarán los
factores de riesgo presentes en ambas regiones.
ABSTRACT
The project goal is to detect the transcripts BCR-ABL, E2A-PBX1, MLLAF4. ETV6-AML1 by MULTIPLEX PCR and determine their usefulness in establishing
prognosis.
Mononuclear cells were obtained from bone marrow samples from 143 patients with
acute lymphoblastic leukemia using ficoll. We performed RNA extraction and reverse
transcription. Then assessed the quality of the cDNA by amplified ABL control gene and
finally evaluated the presence of the four transcripts by multiplex PCR.
Ten patients were found positive for different BCR-ABL transcripts, corresponding
to 7%, which corresponds to the data reported internationally. And six patients positive
(4.5%) for ETV6-AML1, which is a marker of good prognosis, this incidence is quite low
as in developed countries is reported up to 20% positivity. And three patients positive
(2%) for E2A-PBX1.
The presence of BCR-ABL in acute lymphoblastic leukemia indicates very poor
prognosis, so we have proceeded to immediately inform the treating physicians, likewise
have been reported in these patients is necessary to use more aggressive chemotherapy
regimen, and possibly in combination with imatinib and bone marrow transplantation. The
presence of E2A-PBX1, is also a marker of poor prognosis, which directs more aggressive
chemotherapy regimens. And finally the presence of ETV6-AML1 is indicates good
prognosis.
The
low incidence
of ETV6-AML1 gene found
in Guatemala, coincides
with
countries like Spain and India, with which the Guatemalan population share more genetic
polymorphisms.
In demographics, the majority of patients analyzed are from the western and central
Guatemala, so in a future project will assess the risk factors present in both regions.
BIBLIOGRAFÍA BREVE ACADÉMICA DE AUTORES
.
1. Dra. Claudia Carranza PhD.
En el año 2004 se gradúo de Química Bióloga en la Universidad de San Carlos,
Posteriormente en el período 2005-2007 cursó un programa de Doctorado en
Biología Molecular y Celular, especializado en el área de Genética, en el Centro de
Investigación Médica Aplicada –CIMA- , Universidad de Navarra, Pamplona
España. En el año 2008, se incorpora en el Instituto de Investigación en
enfermedades Genéticas y Métabolicas –INVEGEM-, Guatemala; y también se
incorpora como catedrática titular del curso de Bioquímica Humana en la Facultad
de Medicina, Universidad Francisco Marroquín. Su línea de investigación se ha
centrado en Genética humana, Biología Molecular del Cáncer, Genética de
neoplasias hematológicas. Actualmente se encuentra cursando un Máster en
Bioética en la Universidad del Istmo, Guatemala ( 2011-2012).
2. Licda. Lilian Granados
Pensum cerrado de la carrera de Química biológica, de la Facultad de Farmacia,
Universidad San Carlos de Guatemala. Actualmente se encuentra laborando como
investigadora en el Instituto de Investigación de Enfermedades Genéticas y
Metabólicas –INVEGEM- .
OTROS AGRADECIMIENTOS:
La realización de este trabajo, ha sido posible gracias al:
• Apoyo financiero
y académico del Instituto de Investigación en
Enfermedades Genéticas y Metabólicas –INVEGEM-.
• Apoyo financiero de la Fundación Rozas-Botrán.
• Cooperación de la Unidad de Oncología Pediátrica –UNOP• Cooperación del Dr. Mauricio Villegas, Dr. Cáceres y Dra. Silvana Torselli.
TABLA DE CONTENIDOS:
LISTA DE FIGURAS ……………………………………………………..…..
LISTA DE TABLAS ……………………………………………………………
v
xvii
RESUMEN ……………………………………………………………………...
xix
ABSTRACT……………………………………………………………………..
xx
PARTE I:
I.1 INTRODUCCIÓN ………………………………………………....
I.2 PLANTEAMIENTO DEL TEMA…………………………………
I.2.1 Antecedentes en Guatemala………………………………………...
I.2.2 Justificación del trabajo de investigación…………………………...
I.3 OBJETIVOS ………………………………………………………..
I.3.1 Objetivos
I.3.1.1 General…………………………………………………….
I.3.1.2 Específicos…………………………………………………
I.3.2 Hipótesis…………………………………………………………….
I.4 METODOLOGÍA …………………………………………………..
I.4.1 Localización…………………………………………………………
1.4.2 Indicadores………………………………………………………….
I.4.3 Estrategia Metodológica……………………………………………
I.4.4 El Método……………………………………………………………
I.4.5 La técnica Estadística………………………………………………..
1.4.6 Los instrumentos a utilizar…………………………………………..
4
4
5
6
6
6
6
7
12
12
PARTE II
MARCO TEÓRICO ( CONCEPTUAL)………………………………………
13
PARTE III
III. RESULTADOS……………………………………………………………..
III.1 Discusión de Resultados…………………………………………….
48
80
PARTE IV
IV.1 CONCLUSIONES………………………………………………………...
IV.2 RECOMENDACIONES…………………………………………………
IV.3 REFERENCIAS BIBLIOGRÁFICAS………………………………….
IV.4 ANEXOS…………………………………………………………………...
85
87
88
96
PARTE V
V.1 INFORME FINANCIERO………………………………………………..
166
1
2
2
3
4
LISTA DE FIGURAS
PAG.
Figura no. 1: Clasificación citomorfológica de leucemia aguda…………………….
18
Figura no. 2: Clasificación fab de la leucemia infantil………………………………
18
Figura no. 3: Esquema de la t(9;22) mostrando la localización de los genes abl y bcr.
24
Figura no 4: El cromosoma 22 afectado por la translocación es el denominado
cromosoma philadelphia……………………………………………………………..
25
Figura no. 5: Representación esquemática de la fusión génica bcr-abl………………
26
Figura no. 6: Localización de los puntos de rotura en los genes abl y bcr…………….
27
Figura no. 7: Probabilidad de recaídas de pacientes bcr-abl…………………………..
28
Figura no. 8: Curva de sobrevivientes libres de enfermedad con etv6-aml1 positivo..
33
Figura no. 9: Representación esquemática del gen etv6, mostrando sus puntos de rotura 33
Figura no. 10: Representación esquemática de la fusión génica tel-aml1…………….
37
Figura no. 11: Curva de eventos sobrevivientes libres de enfermedad………………
39
Figura no. 12 y13: Gen mll y su fusión con otros genes……………………………..
41
Figura no. 14: Representación esquemática de la fusión génica e2a-pbx1…………..
44
Figura no. 15: Amplificación del gen control abl……………………………………
48
Figura no. 16: Transcrito bcr-abl; pacientes 1 y 7……………………………………
53
Figura no. 17: Transcrito bcr-abl; pacientes 24, 32 y 35…………………………….
53
Figura no. 18: Transcrito bcr-abl; pacientes 40,41 y 97……………………………..
54
Figura no. 19: Transcrito bcr-abl; pacientes 121 y 123……………………………..
54
Figura no. 20: Transcrito etv6-aml1; pacientes 27, 120 y 128………………………
55
Figura no. 21: Transcrito etv6-aml1; pacientes 59………………………………….
56
Figura no. 22: Transcrito e2a-pbx1; pacientes 20, 43 y 47…………………………
56
Figura no. 23: Resultado de alineación de secuencia de ADN obtenida, paciente no. 97 63
Figura no. 24: Cromosomas que contienen la secuencia analizada, paciente no. 97….
…
64
Figura no. 25: Alineación de la secuencia obtenida con el gen abl, paciente no. 97…
64
Figura no. 26: Alineación de la secuencia obtenida con el gen bcr, paciente no. 97…
65
Figura no. 27: Alineación de la secuencia obtenida, paciente no. 97 (2)…………….
66
Figura no. 28: Cromosomas que contienen la secuencia analizada, paciente no. 97 (2)
66
Figura no. 29: Alineación de la secuencia obtenida con el gen abl, paciente no. 97 (2)
67
LISTA DE FIGURAS
PAG
Figura no. 30: Alineación de la secuencia obtenida con el gen bcr, paciente no. 97 (2)
67
Figura no. 31: Alineación de la secuencia obtenida, paciente no. 43……………….
68
Figura no. 32: Cromosomas que contienen la secuencia analizada, paciente no. 43..
68
..
Figura no. 33: Alineación de la secuencia obtenida con el gen pbx1, paciente no. 43
69
Figura no. 34: Alineación de la secuencia obtenida, paciente no. 43 (2)……………
70
Figura no. 35: Cromosomas que contienen la secuencia analizada, paciente no. 43 (2) ...
70
Figura no. 36: Alineación de la secuencia obtenida con el gen e2a, paciente no. 43 (2)
71
Figura no. 37: Alineación de la secuencia obtenida con el gen pbx1, paciente no. 43 (2) 71
Figura no. 38: Alineación de la secuencia obtenida, paciente no. 40……………….
72
Figura no. 39: Cromosomas que contienen la secuencia analizada, paciente no. 40…
72
Figura no. 40: Alineación de la secuencia obtenida con el gen abl1, paciente no. 40
73
Figura no. 41: Alineación de la secuencia obtenida con el gen bcr, paciente no. 40
73
Figura no. 42: Alineación de la secuencia obtenida, paciente no. 40 (2)……………
74
Figura no. 43: Cromosomas que contienen la secuencia analizada, paciente no. 40 (2)
74
Figura no. 44: Alineación de la secuencia obtenida con el gen abl, paciente no. 40 (2)
75
Figura no. 45: Alineación de la secuencia obtenida con el gen bcr, paciente no. 40 (2)
75
Figura no. 46: Alineación de la secuencia obtenida, paciente no. 41……………….
76
Figura no. 47: Cromosomas que contienen la secuencia analizada, paciente no. 41…
76
Figura no. 48: Alineación de la secuencia obtenida con el gen bcr, paciente no. 41
77
Figura no. 49: Alineación de la secuencia obtenida, paciente no. 41 (2)……………
78
Figura no. 50: Cromosomas que contienen la secuencia analizada, paciente no. 41 (2)
78
Figura no. 51: Alineación de la secuencia obtenida con el gen abl, paciente no. 41 (2)
78
Figura no. 52: Alineación de la secuencia obtenida con el gen bcr, paciente no. 41 (2)
79
Figura no. 53: Líneas celulares k562, reh y mv4-11 en hielo seco………………….
97
Figura no. 54: Medio de cultivo rpmi y suero fetal bovino…………………………
97
Figura no. 55: Cultivo de líneas celulares en el medio de cultivo rpmi…………….
98
Figura no. 56: Distintos cultivos de líneas celurares en incubación………………..
98
Figura no. 57: Observación al microscopio de cultivos celulares………………….
100
Figura no. 58: Líneas celulares observadas al microscopio………………………..
100
Figura no. 59: Filtro utilizado para extracción de arnm…………………………...
101
LISTA DE FIGURAS
PAG
Figura no. 60: Procedimiento de retrotranscripción………………………………
102
Figura no. 61: Separación de células mononucleares de médula ósea por medio de
Ficoll………………………………………………………………………………
103
Figura no. 62: Células mononucleares en interfase, después de separación con ficoll 103
Figura no. 63: Gen control abl, pacientes no.1 y 2……………………………….
106
Figura no. 64: Gen contrl abl, pacientes no. 3-7………………………………….
106
Figura no. 65: Gen control abl, pacientes no. 8 al 14……………………………
107
Figura no. 66: Gen control abl, pacientes no. 15 al 20…………………………..
107
Figura no. 67: Gen control abl, pacientes no. 21 al 24…………………………..
108
Figura no. 68: Gen control abl, pacientes no. 25 al 27…………………………..
108
Figura no. 69: Gen control abl, pacientes no. 27 y 28……………………………
109
Figura no. 70: Gen control abl, pacientes no. 29 y 30……………………………
109
Figura no. 71: Gen control abl, pacientes no. 31 al 36……………………………
110
Figura no. 72: Gen control abl, pacientes no. 37 al 39……………………………
110
Figura no. 73: Gen control abl, pacientes no. 40 al 43……………………………
111
Figura no. 74: Gen control abl, pacientes no. 44 al 48……………………………
111
Figura no. 75: Gen control abl, pacientes no. 49 al 51……………………………
112
Figura no. 76: Gen control abl, pacientes no. 52 al 54……………………………
112
Figura no. 77: Gen control abl, pacientes no. 53 y 54…………………………….
113
Figura no. 78: Gen control abl, pacientes no. 56 al 63…………………………….
113
Figura no. 79: Gen control abl, pacientes no. 65 al 73……………………………
114
Figura no. 80: Gen control abl, pacientes no. 8 al 14…………………………….
114
Figura no. 81: Gen control abl, pacientes no. 72 al 75……………………………
115
Figura no. 82: Gen control abl, pacientes no. 75 al 80……………………………
115
Figura no. 83: Gen control abl, pacientes no. 81 al 85……………………………
116
Figura no. 84: Gen control abl, pacientes no. 84,86 y 89…………………………
116
Figura no. 85: Gen control abl, pacientes no. 88 y 93…………………………….
117
Figura no. 86: Gen control abl, pacientes no. 90,92 y 95…………………………
117
Figura no. 87: Gen control abl, pacientes no. 90, 94 y 99…………………………
118
LISTA DE FIGURAS
PAG
Figura no. 88: Gen control abl, pacientes no. 101-104…………………………….
118
Figura no. 89: Gen control abl, pacientes no. 88, 96, 98 y 102……………………
119
Figura no. 90: Gen control abl, pacientes no. 97 y 100……………………………
119
Figura no. 91: Gen control abl, pacientes no. 105-108……………………………
120
Figura no. 92: Gen control abl, pacientes no. 105, 107 y 109…………………….
120
Figura no. 93: Gen control abl, pacientes no. 110 al 114…………………………
121
Figura no. 94: Gen control abl, paciente 115………………………………………
121
Figura no. 95: Gen control abl, pacientes no. 116 al 119………………………….
122
Figura no. 96: Gen control abl, paciente no. 118………………………………….
122
Figura no. 97: Gen control abl, pacientes no. 120 al 125………………………….
123
Figura no. 98: Gen control abl, paciente no. 126………………………………….
123
Figura no. 99: Gen control abl, paciente no. 127………………………………….
124
Figura no. 100: Gen control abl, pacientes no. 128 al 132………………………...
124
Figura no. 101: Gen control abl, pacientes no. 133 al 138…………………………
125
Figura no. 102: Gen control abl, pacientes no. 139 al 142…………………………
125
Figura no. 103: Transcrito e2a-pbx1, pacientes no. 3 al 7…………………………
126
Figura no. 104: Transcrito e2a-pbx1, pacientes no. 15 al 20………………………
126
Figura no. 105: Transcrito e2a-pbx1, pacientes no. 21 al 27………………………
127
Figura no. 106: Transcrito e2a-pbx1, etv6-aml1 y mll-af4 pacientes no. 28 al 30
127
Figura no. 107: Transcrito e2a-pbx1, pacientes no. 30 al 36………………………
128
Figura no. 108: Transcrito e2a-pbx1, pacientes no. 37 al 43………………………
128
Figura no. 109: Transcrito e2a-pbx1, paciente no. 43……………………………..
129
Figura no. 110: Transcrito e2a-pbx1, pacientes no. 39 al 48………………………
129
Figura no. 111: Transcrito e2a-pbx1, paciente no. 47……………………………..
130
Figura no. 112: Transcrito e2a-pbx1, pacientes no. 49 al 54………………………
130
Figura no. 113: Transcrito e2a-pbx1, pacientes no. 57 al 64………………………
131
Figura no. 114: Transcrito e2a-pbx1, pacientes no. 53, 55, 57, 59, 61 y 62………
131
Figura no. 115: Transcrito e2a-pbx1, pacientes no. 60,63 y 65…………………..
132
Figura no. 116: Transcrito e2a-pbx1, pacientes no. 65 al 74……………………..
132
Figura no. 117: Transcrito etv6-aml1, pacientes no. 3 al 7……………………….
133
LISTA DE FIGURAS
PAG
Figura no. 118: Transcrito e2a-pbx1 y etv6-aml1, pacientes no. 8 al 14…….
134
Figura no. 119: Transcrito etv6-aml1, pacientes no. 15 al 20…………………
135
Figura no. 120: Transcrito etv6-aml1, pacientes no. 21 al 27…………………
135
Figura no. 121: Transcrito etv6-aml1, pacientes no. 31 al 36…………………
136
Figura no. 122: Transcrito etv6-aml1, pacientes no. 37 al 43…………………
136
Figura no. 123: Transcrito etv6-aml1, pacientes no. 39 al 48…………………
137
Figura no. 124: Transcrito etv6-aml1, pacientes no. 49 al 51…………………
137
Figura no. 125: Transcrito etv6-aml1, pacientes no. 57 al 64…………………
138
Figura no. 126: Transcrito etv6-aml1, pacientes no. 53 al 62…………………
138
Figura no. 127: Transcrito etv6-aml1, pacientes no. 52 y 54…………………
139
Figura no. 128: Transcrito etv6-aml1, pacientes no. 65 al 74…………………
139
Figura no. 129: Transcrito bcr-abl, pacientes no. 1 y 2……………………….
140
Figura no. 130: Transcrito bcr-abl, pacientes no. 3 al 7………………………
140
Figura no. 131: Transcrito bcr-abl, pacientes no. 8 al 14……………………..
141
Figura no. 132: Transcrito bcr-abl, pacientes no. 15 al 22……………………
141
Figura no. 133: Transcrito bcr-abl, pacientes no. 23 al 27……………………
142
Figura no. 134: Transcrito bcr-abl, pacientes no. 27 al 30……………………
142
Figura no. 135: Transcrito bcr-abl, pacientes no. 31 al 36……………………
143
Figura no. 136: Transcrito bcr-abl, pacientes no. 37 al 43……………………
143
Figura no. 137: Transcrito bcr-abl, pacientes no. 40 y 41……………………
144
Figura no. 138: Transcrito bcr-abl, pacientes no. 39 al 48……………………
144
Figura no. 139: Transcrito bcr-abl, pacientes no. 49 al 51……………………
145
Figura no. 140: Transcrito bcr-abl, pacientes no. 57 al 64…………………...
145
Figura no. 141: Transcrito bcr-abl, pacientes no. 60, 63 y 65………………..
146
Figura no. 142: Transcrito bcr-abl, pacientes no. 53, 55, 59, 61 y 62……….
146
Figura no. 143: Transcrito bcr-abl, pacientes no. 52 y 54……………………
147
Figura no. 144: Transcrito bcr-abl, pacientes no. 65 al 74…………………..
147
Figura no. 145: Transcrito mll-af4, pacientes no. 3 al 7……………………..
148
Figura no. 146: Transcrito mll-af4, pacientes no. 8 al 14……………………
148
Figura no. 147: Transcrito mll-af4, pacientes no. 15 al 20…………………..
149
LISTA DE FIGURAS
PAG
Figura no. 148: Transcrito mll-af4, pacientes no. 21 al 27……………………….
149
Figura no. 149: Transcrito mll-af4, pacientes no. 31 al 36……………………….
150
Figura no. 150: Transcrito mll-af4, pacientes no. 37 al 43……………………….
150
Figura no. 151: Transcrito mll-af4, pacientes no. 39 al 48………………………
151
Figura no. 152: Transcrito mll-af4, pacientes no. 49 al 51……………………….
151
Figura no. 153: Transcrito mll-af4, pacientes no. 52 y 54………………………..
152
Figura no. 154: Transcrito mll-af4, pacientes no. 53 al 62……………………….
152
Figura no. 155: Transcrito mll-af4, pacientes no. 57 al 64……………………….
153
Figura no. 156: Transcrito mll-af4, pacientes no. 65 al 74……………………….
153
Figura no. 157: Transcrito bcr-abl y ee2-pbx1, pacientes no.72 al 75……………
154
Figura no. 158: Transcrito etv6-aml1 y mll-af4, pacientes del 72 al 75………….
154
Figura 158: Todos los transcritos, pacientes del 76 al 80…………………………
155
Figura no. 159: Todos los transcritos, pacientes del 81 al 85…………………….
155
Figura no. 160 : Transcrito bcr-abl, e2a-pbx1, pacientes del 90-96, 99 y 100…..
156
Figura no. 161: Todos los transcritos, paciente 102………………………………
156
Figura no. 162: Todos los transcritos, pacientes 84, 86 y 89……………………..
157
Figura no. 163: Transcrito bcr-abl; pacientes 88, 101 al 104……………………..
157
Figura no. 164: Todos los transcritos, pacientes 105 al 109………………………
158
Figura no. 165: Transcrito bcr-abl, e2a-pbx1, pacientes 115 al 119………………
158
Figura no. 166: Todos los transcritos; pacientes no. 110 al 114…………………..
159
Figura no. 167: Transcrito bcr-abl y e2a-pbx1, pacientes del 120 al 132…………
159
Figura no. 168: Todos los transcritos, pacientes 121, 123 ,125 y 126…………….
160
Figura no. 169: Transcrito bcr-abl, pacientes no. 133 al 142……………………..
160
Figura no. 170: Transcrito e2a-pbx1 y etv6-aml1, pacientes 133 a 142…………..
161
Figura no. 171: Transcritos bcr-abl y etv6-aml1, pacientes 121, 123, 120 y 128…
161
Figura no. 172: Transcritos etv6-aml1 y mll-af4, pacientes 115 al 119……………
162
Figura no. 173: Transcrito etv6-aml1, pacientes 120, 123, 124, 127-131…………
162
Figura no. 174: Transcrito mll-af4, pacientes 133 al 142………………………….
163
LISTA DE TABLAS
•
PAG.
Tabla no. 1: Peso molecular de transcritos estudiados…………………..
10
• Tabla 2: Anormalidades genéticas en leucemia linfoblástica aguda. …...
23
• Tabla no. 3: características con valor en el pronóstico de leucemia
linfoblástica aguda………………………………………………………..
•
47
Tabla no. 4: Resultados del análisis de los cuatro transcritos en todos los
Pacientes………………………………………………………………….
49
• Tabla no. 5: Incidencia de cada unos de los transcritos ………………….
52
• Tabla no. 6: Pronóstico y orientación a tratamiento de los transcritos
encontrados en los pacientes……………………………………………..
57
• Tabla no. 7: Pacientes con la distribuidos por municipio de Guatemala…
58
• Tabla no 8: Cantidad de pacientes organizados por región………………
62
• Tabla no. 9: Frecuencia de etv6-aml1 en distintos países………………..
82
• Tabla no. 10: Cantidad de células de cada línea celular por ml………….
99
• Tabla no. 11: Concentración del ADNc………………………………….
102
• Tabla no. 12: Datos clínicos de pacientes analizados
para las cuatro translocaciones…………………………………………...
165
RESUMEN
El objetivo general del proyecto Fodecyt 48-2009 es detectar los transcritos
de fusión BCR-ABL, E2A-PBX1, MLL-AF4. ETV6-AML1 mediante PCR
MULTIPLEX y determinar su utilidad en el establecimiento de un pronóstico.
Se obtuvieron células mononucleares de muestras de médula ósea de 143
pacientes con diagnóstico de leucemia linfoblástica aguda, mediante el uso de ficoll.
Se realizó la extracción de ARN y la retrotranscripción. Posteriormente se evalúo la
calidad del cDNA amplificando el gen control ABL y por último se evalúo la
presencia de los cuatro transcritos mediante PCR multiplex.
Se ha encontrado diez pacientes positivos para distintos transcritos de BCRABL, que corresponde a un 7%, el cual
concuerda con lo reportado
internacionalmente. Y seis pacientes positivos ( 4.5%) para ETV6-AML1, que es un
marcador de buen pronóstico, esta incidencia es bastante baja ya que en países
desarrollados se reporta hasta un 20% de positividad. Y tres pacientes positivos
(2%) para el transcrito E2A-PBX1.
La presencia de BCR-ABL en leucemia linfoblástica aguda indica muy mal
pronóstico, por lo que se ha procedido a informar inmediatamente a los médicos
tratantes; así mismo se ha informado de que en estos pacientes es necesario utilizar
esquemas de quimioterapias más agresivas, y de ser posible en combinación con
Imatinib y transplante de médula ósea. La presencia de E2A-PBX1, también es un
marcador de mal pronóstico, y que orienta a esquemas de quimioterapia más
agresivas. Y por último la presencia de ETV6-AML1 es indica buen pronóstico.
La baja incidencia del gen ETV6-AML1 encontrada en Guatemala, coincide
con países como España e India, con los cuales la población guatemalteca comparte
mayor cantidad de polimorfismos genéticos.
En los datos demográficos, la mayoría de pacientes analizados proceden del
occidente y centro de Guatemala; por lo que en un futuro proyecto se evaluarán los
factores de riesgo presentes en ambas regiones.
ABSTRACT
The project goal is to detect the transcripts BCR-ABL, E2A-PBX1, MLLAF4. ETV6-AML1 by MULTIPLEX PCR and determine their usefulness in establishing
prognosis.
Mononuclear cells were obtained from bone marrow samples from 143 patients with
acute lymphoblastic leukemia using ficoll. We performed RNA extraction and reverse
transcription. Then assessed the quality of the cDNA by amplified ABL control gene and
finally evaluated the presence of the four transcripts by multiplex PCR.
Ten patients were found positive for different BCR-ABL transcripts, corresponding
to 7%, which corresponds to the data reported internationally. And six patients positive
(4.5%) for ETV6-AML1, which is a marker of good prognosis, this incidence is quite low
as in developed countries is reported up to 20% positivity. And three patients positive
(2%) for E2A-PBX1.
The presence of BCR-ABL in acute lymphoblastic leukemia indicates very poor
prognosis, so we have proceeded to immediately inform the treating physicians, likewise
have been reported in these patients is necessary to use more aggressive chemotherapy
regimen, and possibly in combination with imatinib and bone marrow transplantation. The
presence of E2A-PBX1, is also a marker of poor prognosis, which directs more aggressive
chemotherapy regimens. And finally the presence of ETV6-AML1 is indicates good
prognosis.
The
low incidence
of ETV6-AML1 gene found
in Guatemala, coincides
with
countries like Spain and India, with which the Guatemalan population share more genetic
polymorphisms.
In demographics, the majority of patients analyzed are from the western and central
Guatemala, so in a future project will assess the risk factors present in both regions.
PARTE I
I.1
INTRODUCCIÓN
La biología molecular es una herramienta útil para la genética humana, pues permite
el
diagnóstico de una gran variedad de enfermedades de origen genético. Entre las
enfermedades de origen genético se pueden mencionar las constitucionales como el
síndrome de Down, y las adquiridas como los distintos tipos de neoplasias.
Actualmente las neoplasias se consideran de origen genético, debido a que se han
encontrado una gran infinidad de alteraciones en cromosomas, que dan origen a numerosos
procesos alterados, como la síntesis de proteínas irregulares, o que causan sobreexpresión o
silenciamiento génico. Estos procesos genéticos alterados causan una disfunción en algún
proceso celular esencial; produciendo un desequilibrio entre el crecimiento celular, la
diferenciación celular y la apoptosis. [1-3]
La descripción de alteraciones cromosómicas asociadas específicamente a un tipo de
cáncer, y su posterior seguimiento, ha permitido conocer la significación clínica de muchos
marcadores genéticos y, más importante todavía, se ha constituido como un paso previo a la
detección y localización de los genes implicados en la génesis tumoral. [1-3]
Las técnicas genéticas que poseen actualmente mayor aplicación y que se han
incorporado como técnicas de rutina en una gran cantidad de laboratorios clínicos son el
cariotipo, la citogenética molecular y la biología molecular. Estas técnicas proporcionan
amplia información sobre el diagnóstico, pronóstico y el tipo de terapia a seguir en los
pacientes con neoplasias hematológicas. [1-3]
En el presente estudio, se utilizó la técnica de PCR MULTIPLEX, para determinar la
presencia de los transcritos BCR-ABL, E2A-PBX1, MLL-AF4 y ETV6-AML1; estos
cuatro genes de fusión brindan información sobre el pronóstico y la terapia a elegir en
pacientes pediátricos con leucemia linfoblástica aguda. Esta determinación brindará de gran
apoyo al clínico hematólogo para el diagnóstico y seguimiento de la leucemia linfoblástica
aguda.
I.2
PLANTEAMIENTO DEL PROBLEMA (Antecedentes y Justificación del trabajo
de investigación)
I.2.1 Antecedentes (Trabajo, experiencias en Guatemala)
En Guatemala, la genética humana se encuentra desarrollada pobremente.
Actualmente no existen publicaciones guatemaltecas que involucren estudios de genética en
humanos. La biología molecular es una herramienta útil para el área de genética humana.
Los estudios sobre enfermedades de origen genético como las neoplasias
hematológicas poseen un alto impacto en países en vías de desarrollo como Guatemala.
Pues gracias a estos estudios se puede apoyar en diagnóstico y pronóstico al clínico
hematólogo. Y por otro lado también es posible la caracterización genética de nuestra
población en distintas enfermedades.
El único estudio epidemiológico sobre leucemias infantiles realizado en
Centroamérica, incluyendo México, fue el realizado por Arangúre y colaboradores; en
donde se incluyeron datos de pacientes desde 1996 hasta el 2000. El promedio anual de
incidencia obtenido fue de: 44.9 por millón de niños para leucemia linfoblástica aguda –
LLA-( el principal tipo de leucemia infantil). [4]
A nivel mundial, principalmente en países desarrollados se han implementado como
técnicas de rutina, el análisis de la presencia de distintos marcadores genéticos para LLA
como los transcritos de fusión BCR-ABL, E2A-PBX1, MLL-AF4 y ETV6-AML1; que
proporcionan información importante acerca del pronóstico y la terapia a escoger.
Cerveira y colaboradores en el año 2000; Pallisgaard y colaboradores en el año
1998, Scurto y colaboradores en el año 1998; y Marin Carolina en el año 2001; han
desarrollado distintas técnicas de PCR Múltiplex para el análisis de algunos de estos
transcritos; indicando todos la importancia de la detección en una sola prueba de estas
translocaciones. Así como también todos resaltan su utilidad para el establecimiento de un
pronóstico adecuado a cada paciente. [5-9]
Se ha tenido experiencia en la caracterización genética de neoplasias hematológicas
mediante la utilización de distintas técnicas moleculares y de citogenética, principalmente
en en la búsqueda de nuevos mecanismos que expliquen la sobreexpresión del gen EVI1,
un gen importante en leucemias mieloides agudas. [10]
I.2.2 Justificación del trabajo de investigación
El diagnóstico de leucemia linfoblástica aguda (ALL), se realiza en primer término
con
un recuento periférico
de glóbulos blancos alterado, y posteriormente mediante
citomorfología, empezando con un análisis de frote periférico en busca de presencia de
blastos (células hematopoyéticas inmaduras), para luego proceder a la realización de un
medulograma. [1-3]
El examen completo de un medulograma debe constar de las siguientes partes:
recuento globular, análisis morfológico de frote, inmunofenotipo, citoquímica, citogenética
y biología molecular; siendo estos dos últimos los que proporcionan una información
completa acerca del diagnóstico, pronóstico y tipo de terapia a seguir.
En Guatemala, el análisis de médula ósea, se realiza mediante un recuento globular y
análisis citomorfológico principalmente. Ambas técnicas permiten el diagnóstico y la
clasificación de una leucemia, según la clasificación FAB (FRENCH, AMERICAN AND
BRITISH); para las leucemias mieloides agudas en
M0-M7,
y para las leucemias
linfoblásticas agudas en L1/L2/L3; esta clasificación se basa en el tipo celular encontrado y
el grado de diferenciación que posee. En algunos casos es posible realizar algunas técnicas
citoquímicas y establecer el inmunofenotipo del paciente; ayudando estas técnicas a
establecer un diagnóstico más certero. Sin embargo estas técnicas son insuficientes para
proporcionar información acerca del pronóstico del paciente y del tipo de terapia a elegir.
[1-3]
La biología molecular permite la detección de marcadores genéticos, que
generalmente proporcionan información más definitiva sobre el diagnóstico del paciente. Y
además dependiendo del tipo de marcador genético encontrado es posible obtener amplia
información sobre el pronóstico que posee el paciente así como establecer una terapia más
adecuada.
I.3
OBJETIVOS E HIPOTESIS
I.3.1
Objetivos
I.3.1.1 General
Detectar por PCR MULTIPLEX, los transcritos de quiméricos BCRABL, E2A-PBX1, MLL-AF4 y ETV6-AML1 y su utilidad como factor
pronóstico en pacientes pediátricos con Leucemia Linfoblástica aguda.
I.3.1.2 Específicos
•
Detectar los transcritos de fusión BCR-ABL, E2A-PBX1, MLL-AF4 y ETV6AML1 mediante PCR MULTIPLEX y determinar su utilidad en el
establecimiento de pronóstico.
•
Estandarizar la técnica de PCR MULTIPLEX para analizar los transcritos
BCR-ABL, E2A-PBX1, MLL-AF4 y ETV6-AML1 en una sola prueba de
laboratorio.
•
Analizar y evaluar la presencia de los distintos transcritos en los pacientes
pediátricos con leucemia linfoblástica aguda.
•
Establecer y evaluar un pronóstico en los pacientes pediátricos con leucemia
linfoblástica aguda, de acuerdo al tipo de marcador encontrado.
•
Orientar al médico sobre el tipo de terapia a seguir, según los marcadores
genéticos encontrados.
•
Determinar y caracterizar genéticamente la población guatemalteca infantil con
leucemia linfoblástica aguda.
•
Divulgar a las autoridades, actores sociales e instituciones en el campo de su
competencia la información de la investigación obtenida.
I.3.2
Hipótesis
Estudios realizados en otros países han comprobado la eficacia de las técnicas de
análisis
molecular en el diagnóstico y pronóstico de pacientes con neoplasias
hematológicas principalmente, y en algunos casos en tumores sólidos. [1-3. 5-9]
Nuestra hipótesis es que la detección en una sola prueba (PCR MULTIPLEX) de los
transcritos de fusión: BCR-ABL, E2A-PBX1, MLL-AF4
y ETV6-AML1
proporcionará información definitiva acerca del diagnóstico del paciente; así como
permitirá conocer el pronóstico de cada paciente analizado, según el tipo de marcador
genético encontrado; y por último se podrá orientar hacia el tipo de tratamiento
recomendado al paciente, según el perfil genético del mismo. Además se ahorrará
tiempo, pues en una sola prueba se detectarán los cuatro transcritos de fusión.
I.4
METODOLOGIA (Descripción detallada de la Metodología)
I.4.1 Localización
El presente estudio, analiza pacientes con leucemia linfoblástica aguda provenientes
de todos los departamentos de Guatemala; y que han sido referidos al Hospital San
Juan de Dios, Hospital Roosevelt y Unidad de Oncología Pediátrica.
I.4.2: Indicadores.
Las positividad de los cuatro transcritos analizados se observará mediante un gel de
electroforesis, que contendrá el producto de PCR. Las bandas en el peso buscado,
corresponderán a la presencia del transcrito.
I.4.3.Estrategia metodológica
El presente estudio es un proyecto descriptivo longitudinal y tranversal; se
identificará la presencia de los marcadores analizados en pacientes con leucemia
linfoblástica aguda; y se brindará la información de pronóstico y tratamiento a los
pacientes, según el marcador encontrado. No se aplicará ningún diseño estadístico
debido a que es un estudio descriptivo.
I.4.3.1 Población y Muestra
POBLACIÓN
La población fue de 143 pacientes pediátricos con diagnóstico de leucemia
linfoblástica aguda originarios de Guatemala.
CRITERIOS DE INCLUSIÓN
•
Paciente con diagnóstico de leucemia linfoblástica aguda
•
0 a 18 años
CRITERIOS DE EXCLUSIÓN
•
Pacientes mayores de 18 años
•
Pacientes con diagnóstico de otra neoplasia
MUESTRA:
Todos los pacientes de 0 a 18 años referidos por los Hospitales Nacionales y
la Unidad de Oncología pediátrica durante el periodo 2010-2011.
I.4.4 El Método
I.4.4.1 MATERIALES Y REACTIVOS [5-10]:
A. Médula ósea de pacientes pediátricos con leucemia linfoblástica aguda.
B. Kit para extracción de linfocitos de sangre periférica o médula ósea (lynphoprep).
C. Kit de extracción de RNA ( Quiagen)
D. Reactivos para retrotranscripción:
•
Tubos eppendorf 1.5 ml RNAsa free
•
H2O DEPC
•
Hexámeros
•
dNTPs
•
Buffer 5X
•
DTT
•
RNASE out
•
enzima SuperScript III.
E. PCR calidad cDNA
•
Cebadores del gen ABL y de la beta microglobulina.
•
Buffer I (10x)
•
Mg+2(25mM)
•
dNTPs (10mM)
•
Taq Gold (5unids/µl)
•
H2O
•
Termociclador
•
Hielo
•
Tubos eppendorf de 1.5 y 0.5
•
vórtex
ultrapura
F. PCR MULTIPLEX
• Cebadores de los transcritos BCR-ABL, TEL-AML1, E2A-PBX1, MLL-AF4
(Lee,
et al 1995, Cerveira, et al. 2000, Kwong and wong, 1997, Poteat et al. 1997, Hunger
et. Al. 1991)
•
Buffer I (10x)
•
Mg+2(25mM)
•
dNTPs (10mM)
•
Taq Gold (5unids/µl)
•
H2O
•
Hielo
•
Tubos eppendorf de 1.5 y 0.5
•
Agarosa
•
Buffer TBE
ultrapura
I.4.4.2 Metodología ( Ver Anexo No.1 )
La metodología utilizada se ha obtenido de estudios realizados por Cerveira y
colaboradores en el año 2000; Pallisgaard y colaboradores en el año 1998, Scurto y
colaboradores en el año 1998; Marin Carolina en el año 2001 y C. Carranza en el año 2007.
[5-10]
Se recolectaron muestras de médula ósea con EDTA, de pacientes pediátricos (0-18
años) cuyo diagnóstico sea Leucemia Linfoblástica aguda, durante el período de un año y
medio correspondientes a los años 2010-2011.
Las muestras analizadas provienen de
pacientes referidos de distintos hospitales como: Hospital Roosevelt, Hospital General San
Juan de Dios y la Unidad de Oncología Pediátrica –UNOP-.
Todos los pacientes firmaron un consentimiento informado y un asentimiento si los niños
podían darlo. [1-3]
La técnica utilizada para la extracción
linfocitos
es la utilización de ficoll
(lymphoprep), que permite la separación celular de acuerdo a un gradiente de densidad. Los
linfocitos obtenidos mediante esta técnica se almacenaron a -20 grados centígrados, para
posteriormente extraer el ARN.
El RNA total se extrajo utilizando el kit RNAquous de
APPLIED BIOSYSTEMS, en la cual se siguieron los procedimientos descritos por el
fabricante.
Para la síntesis de cDNA se utilizará 1µg de RNA, utilizando el kit cDNA
high capacity Transcription de APPLIED BIOSYSTEMS, con hexámeros al azar en 20µl
de reacción en condiciones estándar.
Para comprobar la calidad del c-DNA obtenido, se utilizará una PCR. Amplificando
el gen control ABL, las condiciones de la PCR fueron estandarizadas según el
termociclador utilizado.
La PCR MULTIPLEX para la evaluación de los transcritos de fusión BCR-ABL,
TEL-AML1, E2A-PBX1 y MLL-AF4, se estandarizó según el termociclador utilizado. Los
cebadores son los descritos por Lee, et al 1995, Cerveira, et al. 2000, Kwong and wong,
1997, Poteat et al. 1997 y Hunger et. Al. 1991.
Las condiciones de PCR son 6 minutos a 94 grados, 40 ciclos de 1 minuto a 94, 1 minuto a
60 grados y 1 minuto a 72 grados centígrado. Y por último una extensión final de 5 minutos
a 72 grados centígrados. Se evaluaron los resultados según la tabla No. 1.
TABLA No. 1: PESO MOLECULAR DE TRANSCRITOS ESTUDIADOS
Translocación
transcrito
Peso molecular (bp)
t(9;22)
p210 (b3:a2)
304
t(9;22)
p210 (b2:a2)
234
t(9;22)
p190 (e1:a2)
196
t(12;21)
TEL-AML1
226 Y 265
t(4;11)
MLL-AF4
161 Y 188
t(1;19)
E2A-PBX1
370
Fuente: FODECYT 48-2009
Para la estandarización de la PCR, se utilizaron las líneas celulares K-562, MV4-11 y REH,
las cuales son positivas para los transcritos a analizar. Primero fueron sometidas a cultivo
celular; y cuando se obtuvo una cantidad considerable de estas células se procedió a extraer
el ARN, y se utilizaron como controles positivos, para estandarizar las condiciones de PCR.
Y por último se secuenciaron tres pacientes positivos para BCR-ABL y uno para E2APBX1, esta secuenciación se realizó en MACROGEN, en USA. Esto con el fin de validar
completamente la técnica estandarizada
F. ANALISIS DE RESULTADOS: La recopilación de información del paciente y de los
exámenes realizados se realizará
siguiente formato:
mediante el uso de una boleta de recolección con el
INVEGEM
BOLETA DE RECOLECCION DE DATOS
IDENTIFICACION DEL PACIENTE
Iniciales de paciente
No. de Historia Clínica
Código del paciente
Fecha de toma de
muestra
DATOS SOCIODEMOGRÁFICOS
Edad
Masculino
Género
Femenino
Lugar de Nacimiento
Antecedentes clínicos
familiares
INFORMACION CLINICA
Fecha de diagnostico
Clasificación de
leucemias según
FAB
Estado de la
enfermedad
TRATAMIENTO
(indicar si ha
recibido algún
tratamiento y el
tiempo)
DATOS
HEMATOLOGICOS
( -2010)
--
LLA
Nuevo
Seguimiento
Remisión
Recuento de Leucocitos:
Recuento de Plaquetas:
Porcentaje de blastos en sangre periférica
Nivel de Hemoglobina:
BCR-ABL,
t(9;22)(q34;q11)
ETV6-AML1,
MARCADORES
GENETICOS
Recaída
t(12;21)(p13;q22)
E2A-PBX1,
t(1;19)(q23;p13)
MLL-AF4,
t(4;11)(q21;q23)
I.4.5 La técnica estadística
Al ser un estudio descriptivo no se utilizará ninguna técnica estadística para el análisis de
datos. Las incidencias se obtuvieron, por medio del cálculo del porcentaje de pacientes con
transcritos positivos en su relación con el total de pacientes analizados.
I.4.6 Los instrumentos a utilizar
•
Termocicladores
•
Vórtex
•
Fuente de Voltaje
•
Transiluminador
•
Cámara de electroforesis
•
Pipetas
•
Congeladores
•
Centrífugas,
•
Computadoras
•
Impresoras.
PARTE II
MARCO TEÓRICO (CONCEPTUAL)
A. GENERALIDADES
Una de las técnicas empleadas para la búsqueda de translocaciones u otras
reordenaciones frecuentes en neoplasias hematológicas y algunos tumores sólidos son las
técnicas de análisis molecular. Estas técnicas se emplean tanto para diagnóstico como para
monitorización del paciente. La técnica de análisis molecular más utilizada es la reacción
en cadena de la polimerasa –PCR-. Esta técnica es eficiente siempre y cuando se estudien
genes de tamaño pequeño con un punto de rotura definido (1-3).
La caracterización molecular de las translocaciones cromosómicas observadas en el
cariotipo o mediante citogenética molecular y asociadas a determinados tipos de tumor, ha
permitido la identificación de los genes responsables. La posterior clonación
y
secuenciación de dichos oncogenes permiten el estudio de las translocaciones a nivel
molecular, mediante análisis de ADN o fundamentalmente ARN con la técnica de RT-PCR
(PCR reversa). Un ejemplo característico es analizar la reordenación BCR-ABL asociada a
leucemia mieloide crónica. Actualmente, su uso es necesario como complemento al
cariotipo o al FISH convencional en el diagnóstico y en la monitorización de paciente con
neoplasias (1,3).
B. NOMENCLATURA GENÉTICA
La nomenclatura genética está basada en el consenso alcanzado tras varias
conferencias internacionales. El documento más reciente y autorizado es ISCN (1995):
International System for Human Cytogenetic Nomenclature, Mitelman F. (ed), Basel 1995
(2,3).
Se denomina clon a la población celular derivada de una única célula progenitora.
Se acepta internacionalmente que existe un clon anómalo cuando se encuentran dos o más
células con la misma alteración estructural o con un cromosoma supernumerario. Si la
alteración es la pérdida de un cromosoma, el mismo cambio se tiene que observar al menos
en tres mitosis. Sólo es necesaria la presencia de una célula normal para definir la
existencia de un clon normal.
El término aneuploide indica que el número de cromosomas se desvía del número
diploide (46 cromosomas). Puede ser hiperdiploide (más de 46 cromosomas) o
hipodiploide (menos de 46 cromosomas). Un cariotipo con un número de cromosomas
diploide, pero que es anómalo debido a la presencia de alteraciones estructurales, se
denomina pseudodiploide (1-3).
A continuación vamos a hacer algunas aclaraciones sobre la nomenclatura empleada
para describir un cariotipo. Se refieren tanto a alteraciones constitucionales como
adquiridas.
Primero se especifica el número de cromosomas y se indican los cromosomas sexuales:
46,XY (varón, cariotipo normal), 46,XX (mujer, cariotipo normal).
A continuación se describen las alteraciones, utilizando las abreviaturas apropiadas:
del (deleción), dup (duplicación), inv (inversión), ins (inserción), t (translocación), i
(isocromosoma), r (ring, cromosoma en anillo). Después se indican los cromosomas y
bandas implicadas. Por ejemplo: 46,XY,t(9;22)(q34;q11) (varón con una translocación
recíproca entre los cromosomas 9 y 22, los puntos de rotura están en 9q34 y 22q11).
Las ganancias o pérdidas de cromosomas completos se indican con los signos + ó antes del número del cromosoma implicado. Por ejemplo: 47,XX,+4 (mujer con una
trisomía del cromosoma 4).
Las alteraciones numéricas se representan a partir del número indicado al principio:
47, XX,+21
45,XY,-5,-7,+8
Las alteraciones constitucionales se representan con una c minúscula junto con la
alteración cromosómica. Por ejemplo: 48,XX,+8,+21c (mujer con síndrome de Down, que
presenta además una trisomía del cromosoma 8) (1-3).
C. NEOPLASIAS HEMATÓLOGICAS
Las leucemias agudas son un grupo heterogéneo de enfermedades. Los distintos
subtipos son caracterizados por los rasgos clínicos y los datos de laboratorio encontrados.
Se caracterizan por mal funcionamiento en las células progenitoras hematopoyéticas.
Para un diagnóstico adecuado de las leucemias agudas es necesario el seguimiento
de un protocolo que combine la citomorfología y citoquímica con el inmunofenotipo, y
siempre que sea posible acompañado por métodos citogenéticos y moleculares (1-20).
Actualmente las técnicas citogenéticas y moleculares no solo permiten un
diagnóstico certero, sino que además proporcionan amplia información sobre el pronóstico
del paciente, así como del tratamiento a seguir. Igualmente poseen gran utilidad para el
monitoreo de la respuesta de los pacientes al tratamiento seleccionado (25-39).
El diagnóstico de leucemias empieza por el análisis morfológico de las células
hematopoyéticas en frotes de sangre periférica y de médula ósea. Dicho análisis permite la
clasificación de las leucemias mieloides en los diferentes subtipos establecidos por la FAB
( M0-M7) y proporciona información importante para la clasificación y estratificación de
las leucemias linfoblásticas. (1-3)
El cariotipo es una técnica de citogenética convencional, que en la actualidad
proporciona información acerca del pronóstico al paciente. (1-3)
Las técnicas de citogenética y biología molecular han establecido diferentes
marcadores moleculares que pueden utilizarse tanto para el diagnóstico como para el
seguimiento de la enfermedad. (1-3, 40,42)
Características clínicas
La leucemia es un síndrome hematológico que se caracteriza por la expansión clonal de
células hematopoyéticas como resultado de una alteración en los mecanismos de
proliferación, diferenciación y muerte celular, en cualquiera de las etapas de maduración de
las células sanguíneas. En términos biológicos y clínicos es un cáncer muy diverso, lo que
las manifestaciones clínicas son variables. Los síntomas pueden aparecer de manera
insidiosa o aguda, los cuales son un reflejo de la insuficiencia de la médula ósea y del grado
de afección extramedular. Algunos pacientes sufren infecciones potencialmente letales o
epistaxis durante el curso de la enfermedad o al diagnóstico. En otros casos, la leucemia es
asintomática y se detecta durante un examen físico de rutina. Sin embargo, la mayor parte
de los pacientes presentan síntomas de pocos días de evolución o de algunos meses como
palidez, fatiga y letargia. Las principales manifestaciones de la leucemia en los niños son
marcha claudicante y artralgias. Estos síntomas pueden ser consecuencia de la infiltración
leucémica del periostio o puede deberse a la expansión que las células leucémicas provocan
en la cavidad medular. Cuando existe necrosis en la médula ósea, se manifiesta con intenso
dolor y fiebre. Otros signos y síntomas menos frecuentes son: cefalea, vómito, insuficiencia
respiratoria, oliguria y anuria (11-15, 51).
El examen físico puede revelar fiebre, palidez, petequias y equimosis de la piel y las
mucosas, hemorragias retinianas, linfadenopatias, hepatoesplenomegalia, nefromegalia e
hipersensibilidad a la palpación de los huesos. Generalmente al momento del diagnóstico se
detecta anemia, trombocitopenia y anormalidades en el recuento leucocitario, las cuales
oscilan entre 0.1 a 1,600 x 109 /L y en algunos casos se observa granulocitopenia absoluta.
Aproximadamente dos terceras partes de los pacientes tienen recuentos leucocitarios de <25
x 109 /L. Casi todas las células de la sangre se
identifican como linfoblastos o linfocitos (11-15, 52).
Los niveles de hemoglobina oscilan entre 2 y 15 g/dL y los recuentos plaquetarios suelen
ser bajos con una mediana de 50 x 109 /L. Los pacientes con alta carga tumoral presentan
elevadas concentraciones séricas de ácido úrico como resultado del aumento del
metabolismo de las purinas. Cuando existe afección renal masiva también se elevan las
concentraciones séricas de urea, creatinina y fósforo (11-15, 52).
Clasificación
Aún cuando la aparición de tratamientos más eficaces ha conferido nuevas connotaciones a
la clasificación de la leucemia, en ella se siguen identificando dos grupos principales: aguda
y crónica. En el pasado, esta clasificación se basaba en la sobrevida de los pacientes; sin
embargo actualmente, se reconoce que la leucemia aguda implica la proliferación maligna
de células inmaduras (blastos), mientras que la leucemia crónica, la proliferación de tipos
celulares más diferenciados. Además, de acuerdo con el origen celular, la leucemia crónica
y aguda se clasifican en linfoides y
mieloides. El diagnóstico diferencial, se realiza principalmente por las características
morfológicas (método de Romanovsky) y las propiedades de tinción citoquímica de las
células leucémicas. En general, los linfoblastos tienen una cromatina nuclear homogénea y
fina, sin nucléolo distinguible y con un citoplasma escaso no granular
( Ver figura
No. 1). Los mieloblastos son más grandes, tienen abundante citoplasma granuloso y poseen
uno o más nucléolos diferentes y la característica principal son los bastones de Auer (Ver
figura No. 1) (1-5).
Hasta la fecha las técnicas citoquímicas más importantes son mieloperoxidasas, Sudán
negro B, a-naftil acetato esterasa y a-naftil butirato esterasa. La reacción de la
mieloperoxidasa es positiva en las células de toda la serie granulocítica, débilmente positiva
o negativa en la serie monocítica y siempre negativa en los linfoblastos y en los linfocitos.
El Sudán negro B suele mostrar una positividad paralela a la de la mieloperoxidasa.
Aunque se ha descrito positividad para el Sudán negro B en las células de la leucemia
aguda linfoblástica (LAL), los patrones de coloración difieren (52).
En 1976, con el fin de unificar los criterios de clasificación, el grupo cooperativo FrancoAmericano-Británico (FAB) estableció un método de clasificación basado en las
características morfológicas y en las propiedades de tinción citoquímica de los blastos
leucémicos de la médula ósea. En la clasificación FAB se especifican ocho grupos
principales de leucemia aguda mieloblástica (LAM): M0 a M7, y tres de LAL: tipo L1, L2
y L3 ( Ver figura No. 2). Es importante mencionar que el diagnóstico de la leucemia M0
no puede hacerse tomando como base las pruebas morfológicas y citoquímicas, dado que
los blastos son semejantes a los de la LAL-L2, por lo que es necesario confirmar el
diagnóstico con pruebas inmunológicas. La variante M1 es otra forma poco diferenciada de
LAM, morfológicamente indistinguible de la LAL-2 (52).
FIGURA No. 1: CLASIFICACIÓN CITOMORFOLÓGICA DE LEUCEMIA
AGUDA
En la fotografía A, se observa una Leucemia Linfoblástica aguda, en donde las células poseen un
citoplasma agranular. En la Fotografía B, se observa una Leucemia mieloid aguda, en donde las
células poseen un citoplasma con gránulos.
Fuente: Childhood Leukemia. Head y Pui 1999
FIGURA No. 2: CLASIFICACIÓN FAB DE LA LEUCEMIA INFANTIL
Fuente: Childhood Leukemia, Pui y Crist, 1999.
Etiología
Aunque un pequeño porcentaje de casos está asociado a síndromes genéticos hereditarios
(Anemia de Fanconi, Síndrome de Bloom, Síndrome de Down, etc.) la causa de la leucemia
y los mecanismos involucrados en la oncogénesis hematológica, no han sido
completamente identificados. Sin embargo, muchos factores ambientales como la
exposición a radiación ionizante, agentes químicos, infecciones virales, etc. aumentan el
riesgo para el desarrollo de esta enfermedad. Por ejemplo, se han descrito asociaciones
entre algunos casos de leucemia y de linfoma de Burkitt con el virus Epstein–Barr (VEB); y
entre la leucemia de células T de adulto con el virus VLTH-I. Así también, en adultos
existen evidencias de que tanto la exposición crónica el benceno como el uso de
quimioterapia intensiva con agentes alquilantes o que actúan sobre la DNA topoisomerasa
II, como las epipodofilotoxinas (tenipósido y etopósido) y las antraciclinas, pueden
conducir al desarrollo de una LAM, pero se desconoce el porcentaje de leucemia infantil
que resulta por la exposición a productos químicos. De tal manera que en la mayoría de los
niños no es posible identificar a los factores que favorecen el desarrollo de la leucemia. Es
probable que la causa principal de la LAL infantil sea una o varias mutaciones espontáneas.
Las células madre de la médula ósea tienen un alto índice de proliferación y por lo tanto
son susceptibles de sufrir mutaciones o reordenamientos de genes que participan en la
regulación de la proliferación, diferenciación y muerte celular (1-5, 51,52)
Epidemiología
Entre los diversos tipos de cáncer, la leucemia ocupa el primer lugar de incidencia en los
pacientes pediátricos. En el mundo, anualmente se diagnostican alrededor de 40-50 casos
nuevos por cada 1,000,000 niños menores de 15 años y a diferencia de lo que ocurre con
los adultos, las leucemias infantiles son casi siempre agudas (aproximadamente 80% de
LAL y 18% de LAM), mientras que la leucemia crónica mieloide (LCM) constituye casi
2%. La leucemia crónica linfoide (LCL) sólo se ha descrito en pocos casos (53).
En México, la frecuencia de la leucemia observa un comportamiento similar a lo descrito
en la literatura, existen evidencias de que en los últimos años, no sólo se ha registrado un
incremento en la incidencia de esta patología, sino también en la tasa de mortalidad
principalmente por la LAL. Tan solo en el Instituto Nacional de Pediatría (INP) acuden
anualmente alrededor de 100 casos de leucemia, de los cuales aproximadamente el 81.9%
de ellos se diagnostican como LAL (54).
En general, la incidencia de la LAL es mayor en niños de entre 3 y 5 años de edad y es
ligeramente más común en varones (relación entre niño: niña de 1.4:1.0). Así mismo, en la
raza blanca se observa una mayor frecuencia, que en la raza negra, lo cual podría reflejar
una diferente susceptibilidad genética (51).
El único estudio epidemiológico sobre leucemias infantiles realizado en Centroamérica,
incluyendo México, fue el realizado por
Arangúre y colaboradores; en donde
se
incluyeron datos de pacientes desde 1996 hasta el 2000. El promedio anual de incidencia
obtenido fue de:
44.9 por millón de niños para leucemia linfoblástica aguda; 10.6 por
millón de niños para leucemia mieloide aguda; 2.5 por millón de niños para leucemia
mieloide crónica y un 58.4 por millón de niños para leucemias inespecíficas ( es decir que
no se logró su clasificación) (4).
En Guatemala, no existen estudios epidemiológicos nacionales documentados sobre
la incidencia anual. El hospital general San Juan de Dios atiende aproximadamente al año
40 casos nuevos de leucemia linfoblástica infantil, siendo el principal cáncer en niños que
asisten al hospital.
D. LEUCEMIA LINFOBLÁSTICA AGUDA (LLA)
Es una enfermedad que se caracteriza por una proliferación desordenada de células
inmaduras de la serie hematopoyética linfoide. Esta es la neoplasia hematológica más
frecuente en niños. Su incidencia máxima se encuentra entre los 3 y los 5 años, pero es
posible encontrarla en lactantes. Y puede clasificarse de acuerdo a criterios
citomorfológicos en L1, L2 y L3 (1-3,11,12).
Entre los hallazgos clínicos encontrados se pueden mencionar un malestar general,
pérdida de apetito, fiebre, palidez, anemia y trompocitopenia entre otros.
Las características de ALL que se han asociado a mal pronóstico son: edad menor a
6 meses, recuento de glóbulos blancos mayor de 50,000 / ul y fenotipo CD10-(13).
La LAL es una neoplasia maligna que se caracteriza por la proliferación
desordenada de células inmaduras de la serie linfoide que aunque afecta a niños y adultos,
las características biológicas parecen ser diferentes entre ellos. La leucemia aguda
pediátrica puede iniciarse en la etapa prenatal por la recombinación anormal y la formación
de fusiones génicas durante la hematopoyésis fetal (50).
Clasificación Inmunológica
Uno de los grandes avances en la clasificación de la LLA, fue la identificación de la
expresión de los antígenos de superficie de membrana o de los componentes
citoplasmáticos que han permitido identificar y clasificar a las enfermedades
linfoproliferativas según su origen celular y su estadio de diferenciación; así en general, las
LLA infantiles se pueden clasificar en:
i. Pre- B: Linfoblastos con morfología L1, según la FAB. Estas células son positivas tanto
para las inmunoglobulinas citoplasmáticas (cIg) como para CD19, CD22, HLA-DR, CD10.
Aproximadamente el 80% de casos pediátricos con LAL tienen este inmunofenotipo. En
este grupo se identifican 3 subtipos inmunológicos: pre-B temprana, pre-B común y pre-B
tardía.
ii. Células B: Los linfoblastos con este fenotipo tienen una morfología característica,
designada por la FAB como L3 y son positivas para las inmunoglobulinas de superficie
(sIg). Este subtipo de leucemia está presente en el 3% de los casos de LAL infantil. En
estos pacientes, Silvia Jiménez Morales 11 pueden observarse tumores extramedulares y
más del 90% de los casos presentan cadenas pesadas m de las inmunoglobulinas (Igs) en la
superficie celular. Alrededor de las dos terceras partes de ellos, también expresan cadena
ligera k y el resto cadena ligera l. Las LAL de células
B parecen representar linfomas de Burkitt avanzados en fase leucémica.
iii. Células T: Este subtipo de LAL, se identifica por la expresión de antígenos de
superficie asociados a las células T. Presentan positividad para CD7, CD5 o CD2. Las
leucemias de células T generalmente se presentan en los varones y en grupos de edad
avanzada y se caracterizan por la gran masa de células leucémicas asociado al desarrollo de
infiltración al mediastino.
iv. Pre-B transicionales: Los linfoblastos expresan tanto cadenas pesadas de Igs
citoplásmicas como de superficie y proteínas de cadena ligera (56).
E. CITOGENÉTICA DE LA LEUCEMIA LINFOBLÁSTICA AGUDA
En la LLA pueden encontrarse anormalidades citogenéticas numéricas, están
abarcan únicamente alteraciones en cuanto número de cromosomas. Estas alteraciones se
encuentran en aproximadamente la mitad de los casos de ALL reportados. Entre las
alteraciones numéricas que se encuentran frecuentemente se pueden mencionar:
•
Hiperdiploidía leve: cuando se encuentran de 47 a 50 cromosomas.
•
Hiperdiploidía masiva: cuando se encuentran más de 51 cromosomas.
•
Hipodiploidía: cuando se encuentran menos de 46 cromosomas (12).
Los cariotipos hiperdiploides masivos (51-65 cromosomas) se encuentran asociados
a buen pronóstico. La hiperdiploidía leve esta asociada a u pronóstico moderado; y por el
contrario una hipodiploidía esta asociado a un mal pronóstico.
Por otro lado, se encuentran frecuentemente alteraciones estructurales en
cromosomas, es decir que son alteraciones que afectan la morfología en cromosomas.
Dentro de la gran variedad de alteraciones morfológicas que pueden encontrarse, las más
frecuentes son las translocaciones, que se definen como un intercambio de material
genético entre un cromosoma y otro; obteniéndose como resultado de esta reordenación
genes quiméricos, que dan lugar a transcritos de fusión específicos.
En la LLA todas las alteraciones cromosómicas que se encuentren se consideran
cruciales tanto para el diagnóstico como para las decisiones terapéuticas. Ya que el
pronóstico de los pacientes depende muchas veces de los marcadores genéticos
encontrados. ( Tabla 2) (1-3,11,12).
TABLA 2: ANORMALIDADES GENÉTICAS EN LEUCEMIA
LINFOBLÁSTICA AGUDA.
ANORMALIDADES
GENÉTICAS Y MOLECULARES
TRANSLOCACIÓN
CARACTERÍSTICA CLÍNICA
ASOCIADA
Fusión BCR-ABL
t(9;22)(q34;q11)
Mieloproliferación y mal
pronóstico
Fusión TEL-AML1
t(12;21) alteración críptica
Buen pronóstico
Fusión E2A-PBX
t(1;19)(q23;p13)
Respuesta pobre a tratamiento
con antimetabolitos.
Fusión MLL-AFX1
t(x;11)(q13;q23)
Mal pronóstico
Fusión MLL-AF4
t(4;11) (q21;q23)
Pronóstico pobre
hiperdiploidía
------------
Buen pronóstico
Fusión IgH-Myc
Enfermedad extramedular LL3
Fuente: Leukemia, Scurto, P et al. (1998)
En la tabla No. 2, se encuentran los marcadores genéticos
más frecuentes en ALL, así
como su implicación en pronóstico.
De estos marcadores se han seleccionado cuatro de ellos: la t(9;22)(q34;q11),
t(12;21)(p13;q22), t(4;11) (q21;q23)
y t(1;19)(q23;p13). Estos cuatro marcadores se
consideran importantes pues poseen una frecuencia relativamente alta en pacientes
pediátricos con ALL. Y además proporcionan información importante al clínico acerca del
pronóstico del paciente así como del tipo de tratamiento a utilizar. A continuación se
describen cada uno de los marcadores seleccionados en el presente estudio (51).
G. REODENACION BCR-ABL
En la mayoría de las leucemias, las translocaciones dan lugar a un gen de fusión
que produce un mRNA que codifica una proteína quimérica con propiedades estructurales y
funcionales distintas de las proteínas constitucionales normales. Estas proteínas pueden
activar la transcripción directamente, sin que se requiera la interacción de otras proteínas
específicas. Se han identificado muchos genes de fusión. El caso mejor conocido es el gen
quimérico BCR-ABL, que es resultado de la translocación t(9;22)(q34;q11) que da lugar al
cromosoma Philadelphia (Ph) (Ver figura No. 3, 4 y 5) (14,15).
Esta una de las translocaciones más frecuentes en ALL, ocurre de un 11% a un 29%
en pacientes que involucran la serie B y la serie T de linfocitos.
Generalmente los
pacientes con el cromosoma filadelfia positivo poseen recuentos de glóbulos blancos
elevados (23,000/ul), inmunofenotipos CD34+, CD19+ y CD10+. [14-19]
FIGURA No. 3: ESQUEMA DE LA t(9;22) MOSTRANDO LA LOCALIZACIÓN
DE LOS GENES ABL Y BCR.
9
der(9)
22
5´BCR
22q11
9q34
5´BCR
ABL
3´BCR
ABL
der(22)
33´ BCR
La región 5´ del BCR permanece en el der(22) mientras que la región 3´ se traslada al der(9).
Fuente: British Journal of Haematology. Cerveira, N. (2000)
FIGURA NO 4: EL CROMOSOMA 22 AFECTADO POR LA TRANSLOCACIÓN
ES EL DENOMINADO CROMOSOMA PHILADELPHIA
9
9
22
22
t(9;22)(q34;q11)
Fuente: British Journal of Haematology. Cerveira, N. (2000)
Los genes involucrados en esta translocación son el gen ABL presente en el
cromosoma 9 y el gen BCR en el cromosoma 22. La porción 5´del gen BCR es unida a la
porción 3´del gen ABL formando la forma quimérica BCR-ABL (14-19).
El oncogén quimérico BCR-ABL lleva a la síntesis de proteínas de diferente peso
molecular dependiendo de la localización del punto de rotura. Así es posible distinguir tres
nuevas proteínas de fusión (p190BCR-ABL, p210BCR-ABL y p230BCR-ABL). Los puntos de
rupturas más frecuentes en el gen BCR ocurren en los exones 1(e1), 12(b2), 13(b3) y
19(e19) y el punto de ruptura en el gen ABL habitualmente se produce en el exón 2(a2) (2344).
Cuando se da la unión de los exones b3a2 y/o b2a2 (Región M-bcr) se codifica para
una proteína de 210kD (p210BCR-ABL) la cual se presenta en el 20% a 40% de los pacientes
con Leucemia Linfoblástica aguda (LLA) y es característica en más del 95% de pacientes
con leucemia mieloide crónica (LMC); si los exones e1 y e2 son removidos por el corte y
empalme (Región m-bcr) la unión de e1a2 se transcribe en una proteína de 190kD
(p190BCR-ABL) la cual se detecta en el 60% a 80% de los pacientes con LLA y en menos del
10% para aquellos con LMC. Es posible observar una tercer proteína de fusión próxima a
3’ del extremo distal del gen BCR denominada p230BCR-ABL, la cual resulta de la fusión de
los exones e19a2 (Región µ-bcr), cuya expresión se asocia a leucemias crónicas neutrofilas
y trombocitosis (Ver figura No.5 y 6) (23,44).
FIGURA No. 5: REPRESENTACIÓN ESQUEMÁTICA DE LA FUSIÓN
GÉNICA BCR-ABL
A. Diagrama de la t(9;22). B. Estructura intrón/exón de los genes BCR y ABL involucrados en la
t(9;22). C. Diagrama del transcrito quimérico BCR-ABL
Fuente: Leukemia.Van Dongen y col, 1999.
FIGURA No. 6: LOCALIZACIÓN DE LOS PUNTOS DE ROTURA EN LOS
GENES ABL Y BCR.
En el gen ABL pueden observarse tres puntos de rotura, cercanos al exón Ib, Ia y a2. En el gen
BCR se muestran los exones y los puntos de rotura frecuentes. Además se muestra la estructura
quimérica de los cuatro ARN mensajeros derivados de los distintos puntos de rotura.
Fuente: British Journal of Haematology. Cerveira, N. (2000)
Por consiguiente dependiendo del punto de rotura se pueden obtener cuatro
transcritos diferentes: b2a2, b3a2, e1a2 y e19a2. Estos transcritos se encuentran presentes
en leucemia mieloide crónica y en leucemia linfoblástica aguda, y son indicadores de muy
mal pronóstico. Además la presencia de esta alteración da orientación acerca del tipo de
terapia que el paciente puede recibir; por ejemplo se sabe que estos pacientes responden al
tratamiento con Imatinib, además se sabe que el pronóstico es muy pobre y en muchas
ocasiones se recomienda directamente un trasplante de médula ósea. Como se puede
observar en la figura 7, los pacientes cuyos análisis moleculares fueron positivos para
cualquiera de los transcritos BCR-ABL muestran un mayor porcentaje de recaída conforme
avanzan los años de haber sido trasplantados (14-19).
Actualmente se han desarrollado distintas técnicas moleculares de reacción en
cadena de la polimerasa –PCR- para determinar la presencia de los distintos transcritos (1419).
FIGURA No. 7: PROBABILIDAD DE RECAÍDAS DE PACIENTES BCR-ABL
En la gráfica se muestra la incidencia acumulada de recaídas de pacientes post-transplantados
cuando la PCR para transcritos BCR-ABL es positiva y cuando es negativa. Puede notarse un
incremento de recaídas cuando hay presencia de transcritos en los pacientes afectados.
Fuente: Blood, Deininger M, Goldman J and Melo J. (2000).
El gen ABL localizado en el cromosoma 9q, es el homólogo humano del oncogen vabl del virus de la leucemia murina y codifica para un receptor de tirosina cinasa. ABL es
un gen constituido por 8 exones que como resultado del corte y empalme (splicing)
alternativo del primer exón 1a y 1b, codifica para dos isoformas de una proteína de 145
KDa. La proteína está constituida por tres dominios homólogos a secuencias SRC (SH1,
SH2 y SH3), que se localizan en la región NH2-terminal. El dominio SH1 tiene la función
de tirosina cinasa, mientras que los dominios SH2 y SH3 permiten la interacción con otras
proteínas. Hacía la región 3’ se localiza la secuencia señal de localización nuclear y los
dominios de unión a DNA y actina. La proteína normal ABL está involucrada en la
regulación del ciclo celular, en la respuesta al estrés genotóxico y en la transmisión de
información acerca del ambiente celular a través de la señalización mediada por las
integrinas. Al parecer la proteína ABL tiene un complejo papel como modulador celular que
integra las señales del ambiente extracelular e intracelular e influye en las decisiones para
mantener el ciclo celular y la apoptosis (23-44).
El gen BCR, se localiza en la región q34 del cromosoma 22 y está constituido por 23
exones que codifican para una proteína de 160 KDa. La proteína BCR posee un dominio de
dimerización y un dominio de cinasa, en la región NH2-terminal, además de un dominio
con actividad de GTPasa hacia la región COOH. La proteína BCR está presente en varios
tejidos y aunque existen datos que apoyan la hipótesis de que BCR participa en la
transducción de señales, su verdadero papel permanece sin ser determinado (25,44).
Tanto la p210 como la p190 presentan una mayor actividad de tirosina cinasa
comparada con la proteína ABL normal. La proteína BCR-ABL fosforila residuos de
tirosina de muchas proteínas celulares y activa diferentes rutas de señalización, lo cual
conlleva a la transformación celular. En modelos experimentales, se ha observado que estas
proteínas son capaces de transformar precursores hematopoyéticos por la activación de
señales mitógenas, inhibición de apoptosis y alteraciones en la adhesión de las células al
estroma (25, 30-37).
Vías de señalización activadas por Bcr-Abl
Una consecuencia del incremento de la actividad de la tirosina quinasaradica en que
el BCR-ABL puede fosforilar diferentes sustratos, activando múltiples señales de
transducción en las células. Las vías activadas son RAS, vía Fosfatidilinositol-3-cinasa, JakStat, MAPK y ROS.
- Vía RAS: la activación de Ras se poduce por transducción de señales mediadas por
receptores con actividad tirosin cinasas. Una vez realizada la unión al ligando y
dimerización, los receptores tirosincinasas activados, se unen a moléculas adpatadoras
que contiene los dominios SH2 y SH3 como son Grb-2 y SHC formando complejos de
señalización con factores intercambiadores Ras en la membrana celular. Estos complejos
desencadenan una acumulación de la forma Ras e inducen un efecto antiapoptótico que,
aunque sea insuficiente, es necesario para la transformación derivada de BCR-ABL. La
activación inapropiada del gen Ras por una mutación del gen, ha demostrado ser una
importante vía de la señal de transducción celular para la proliferación y transformación
maligna de los tumores.
- Vía Fosfatidilinositol-3-cinasa: esta vía funciona en la regulación del metabolismo
lipídico fosfoinositídico y en la generación de segundos mensajeros lipídicos
relacionados con la transducción de señales. Se ha visto que una subunidad de esta
proteína se fosforila en residuos tirosina en células que expresan BCR-ABL y forma
complejos con cbl y moléculas adaptadas crk y crkl. PI3 está activado de forma
constitutiva por la translocación BCR-ABL jugando un papel importante en su
transformación (84,85).
- Vía Jak-Stat: El crecimiento de las células hematopoyéticas normales se controla por
citocinas. Los receptores para estas citocinas traducen señales mediante activación de
proteínas denominadas genéricamente Jak (Janus tirosine kinases), que es una familia de
cinasas citoplasmáticas que fosforilan y activan los factores de transcripción STAT
(Signal Transducer and Activators of transcription), BCR-ABL activa constitutivamente
las vías de señalización de JAK y STAT en células hematopoyéticas, siendo STAT 1 y
STAT 5 las tirosin-fosforiladas más importantes. La fosforilación constitutiva de factores
de transcripción STAT han sido reportados en líneas celulares positivas BCR-ABL y en
células primarias con LMC, la activación STAT 5 contribuye a la transformación
maligna a pesar de sus funciones pleiotropicas; su efecto en la transformación de células
BCR-ABL parece ser anti-apoptotico e implica la activación trasncripcional de Bcl-xl. En
contraste con la activación de la vía Jak-Stat por medio de estímulos fisiológicos, BCRABL activa directamente STAT 1 y STAT 5 sin previa fosforilación de proteínas Jak (3544).
- Vía MAPK: un primer acontecimiento de señalización que sigue a la activación de RAS
es la activación de la vía de señalización de proteínas activadoras de mitogénesis con
actividad cinasa (MAPK). Se conocen claramente tres cascadas de MAPK: la cinasa
regulada extracelularmente (ERK), la vía de las Jun cinasas o cinasas activadas por
estrés (SAPK) y la vía de la p28 cinasa. El punto final para cada una de estas vías es la
fosforilación y activación de transcripción. BCR-ABL y v-ABL activan la vía SAPK en
fibroblastos y células hematopoyéticas. Así mismo activan promotores dependientes de
Jun de manera dependiente de RAS, MEPK y SAPK. Mientras que los efectos de BCRABL en la vía JNK parecen ser claros, estudios de la vía ERK muestran que la BCR-ABL
funciona de manera distinta a la mayoría de los receptores con actividad tirosincinasa
(35-44).
- Vía ROS: la transformación de las líneas celulares con BCR-ABL presenta un incremento
de ROS, comparado con las líneas celulares no BCR-ABL. Este incremento es suficiente
para la transformación fenotípica en sí misma. Se ha sugerido que ROS podría actuar
como segundo mensajero en la regulación de la actividad de las enzimas sensibles a la
acción de oxidorreducción (redox), como son las cinasas y fosfatasas. La inhibición de la
proteína tirosin fosfatasa (PTPasa) mediante la modulación redox explicaría el amplio
espectro de las actividades biológicas de ROS. Un incremento de ROS amplifica las
señales de BCR-ABL, posiblemente regulando las proteínas redox-sensibles, como es la
PTPasa celular, la cual también está incrementada. También es de particual interés en la
LMC humana, el hecho de que un incremento de ROS pueda tener consecuencias a largo
plazo en la estabilidad genética. Los niveles de ROS no sólo son modulados por
enzimas, antioxidantes y grupos sulfhidrilos, sino también reaccionados con las bases
del ADN. Aunque las modificaciones pueden ser corregidas eficientemente por los
mecanismos de reparación de ADN, un incremnto persistente de ROS podría inducir la
acumulación de mutaciones en las células de la LMC, que podría contribuir a la
progresión de la enfermedad (35-44).
H. REORDENACIÓN ETV6-AML1
La translocación t(12;21)(p13;q22) da origen al gen de fusión ETV6/AML1
(TEL/AML1, ETV6/RUNX1). Esta translocación es difícil de identificar por citogenética
convencional debido a que sus puntos de rotura están en bandas claras de similar tamaño en
el cromosoma 12 y en el 21; por esta razón es considerada críptica. Únicamente se puede
detectar por FISH y RT-PCR (20-23).
Es la anormalidad cromosómica más común en ALL en niños, ocurre en 18-30%
(44% en población mexicana) del total de los casos y principalmente en niños menores de
10 años. Esta asociado a fenotipos de las células B CD19+ y CD10+, raramente esta
asociada a otras reordenaciones,
y además confiere buen pronóstico. Estos pacientes
muestran una excelente respuesta a la quimioterapia convencional y alcanzan una remisión
rápida libre de recaídas (Ver figura No. 8) (20-23).
FIGURA No. 8: CURVA DE SOBREVIVIENTES LIBRES DE ENFERMEDAD
CON ETV6-AML1 POSITIVO
Se muestra mayor supervivencia en los pacientes ETV6 positivo que en los ETV6 negativo.
Fuente: Proc. Natl. Acad. Sci. Golub T, et al. (1995)
Este gen de fusión es un marcador útil para el estudio de enfermedad mínima
residual, proporcionando alta especificidad, pero una sensibilidad un poco baja (20-23).
FIGURA No. 9: REPRESENTACIÓN ESQUEMÁTICA DEL GEN ETV6,
MOSTRANDO SUS PUNTOS DE ROTURA.
Fuente: Proc. Natl. Acad. Sci. Golub T, et al. (1995)
El gen TEL (también conocido como ETV6) se localiza en el cromosoma 12p13 y está
constituido por 8 exones (240 Kb) ( Ver figura No. 9 y 10) que codifican para una proteína
de 53 y 57 KDa. La proteína TEL es un miembro de la familia de factores de transcripción
ETS que se caracterizan por tener un dominio C-terminal denominado de transactivación
(ETS) y un dominio de oligomerización (HLH). El dominio ETS es codificado por los
exones 6-8 mientras que los exones 3 y 4 codifican para el dominio de oligomerización.
TEL, al igual que los otros miembros de la familia ETS, funciona como un regulador
transcripcional ( 51-57).
Aunque la proteína TEL se detecta en diferentes tejidos, todavía se desconocen los genes
sobre los que actúa; sin embargo, se ha observado que puede reprimir al promotor del
receptor del factor de estimulación de las colonias de macrófagos y a otros genes, cuando
interactúa con proteínas nucleares corepresoras como MSIN3. En modelos experimentales,
se ha determinado que TEL es indispensable para el establecimiento de la hematopoyésis
de la medula ósea postnatal y para mantener el desarrollo vascular del saco vitelino y la
sobrevivencia de ciertas poblaciones celulares en periodo prenatal.
Además se ha
observado que es una proteína necesaria para establecer la hematopoyésis de la médula
ósea de todos los linajes ( 51, 58).
Por otra parte, el gen AML1 (Leucemia Mieloide Aguda 1) localizado en el cromosoma
21q22, también conocido como RUNX1, PEBP2a o CBFa2, se clonó a partir de la t(8;21)
en una leucemia de linaje mieloide. Tiene una longitud de 120 kb y codifica para un factor
de transcripción que forma un complejo heterodimérico con la proteína CBFb2. El
heterodímero se une a secuencias específicas del DNA: TGT/CGGT a través del dominio
RUNT (por su homología con el gen runt de Drosophila) de AML1. Tanto la formación del
complejo CBFa2/CBFb como la unión al DNA, se realiza mediante el dominio central de
118 aminoácidos de la proteína CBFa2 ( 59-61).
AML1 es una proteína que está presente en células hematopoyéticas como linfocitos B y T,
monocitos, granulocitos, megacariocitos y células CD34+ y es esencial para inducir la
diferenciación normal de las células mieloides. Durante el desarrollo; AML1 se expresa
principalmente en células progenitoras de la hematopoyesis. Por lo que se ha observado en
modelos animales, es probable que el papel de AML1 en la diferenciación hematopoyética
sea la de dirigir la expresión adecuada de genes específicos de linaje. Los ratones que
carecen de este gen, mueren in utero por falta de la hematopoyésis y por alteraciones en el
desarrollo del sistema nervioso ( 59-61).
Dado que las mutaciones que alteran la función normal de AML1, resultan en un fenotipo
letal durante la embriogénesis, y las translocaciones Silvia Jiménez Morales
28 que alteran el complejo AML1-CBFb2, interfieren con la transcripción normal
dependiente de AML1, es probable que la transformación sea en parte por la represión
dominante en la expresión de genes blanco de esta proteína. Los ratones que no expresan el
gen aml1 desarrollan anemia y carecen de plaquetas en circulación. Los defectos
hematoyéticos que resultan de la pérdida de la proteína AML1, son intrínsecos a la
hematopoyésis definitiva de las células progenitoras (células madre)
( 51, 62).
Se ha observado que la secuencia a la cual se une el complejo CBFa2-CBFb es crítica en la
expresión tejido-específica de algunos genes hematopoyéticos, como los que codifican para
mieloperoxidasas, el receptor 1 del factor estimulador de colonias (CSF-1), subunidades de
receptores de antígenos de células T, algunas citosinas, el receptor de interleucina 3 (IL-3)
y el factor de estimulación de crecimiento de colonias de macrófagosgranulocito. Por otra
parte, el complejo AML1-CBFb funciona como un organizador transcripcional que recluta
factores específicos para formar un complejo núcleo-proteico o enhanceosoma que
estimulan la transcripción a un linaje específico (51, 59-62).
Estos resultados sugieren que el complejo CBFa2-CBFb funciona como un gran interruptor
que regula tanto positivamente como negativamente una cascada transcripcional
involucrada en el desarrollo del sistema hematopoyético definitivo. Por lo tanto TEL y
AML1 son genes esenciales para el establecimiento de la hematopoyesis (51, 59-62).
Aunque la frecuencia de la t(12;21) varía ampliamente en las diferentes poblaciones del
mundo (3-44%), la fusión de los genes TEL y AML1, sigue siendo la anormalidad genética
más común en pacientes pediátricos con LAL. Con la clonación de la t(12;21)(p13;q22), se
demostró que los sitios de ruptura y fusión de los genes TEL y AML1 ocurren a lo largo de
una región de 18 Kb del intrón 5 del gen TEL, principalmente en una región polimórfica de
repetidos Alu y en el intrón 1 de AML1, por lo que la t(12;21) resulta en la fusión del exón 1
al 5 de TEL con el exón 2 al 8 de AML1 (Ver figura No. 10). De tal manera que, el gen
quimérico contiene las primeras 1033 bases del gen TEL y casi todo el gen AML1 (Ver
figura No. 10). Esta translocación produce dos genes híbridos: TEL-AML1 y AML1-TEL,
pero solamente la fusión TEL-AML1 se expresa en todos los pacientes con la t(12;21);
AML1-TEL, sólo se observa en un grupo pequeño Por lo tanto, los casos positivos expresan
la misma proteína quimérica, cuya expresión está controlada por el promotor del gen TEL.
La t(12;21) también puede resultar en la expresión de un gen quimérico, en el que se
observa la fusión del exón 5 del gen TEL con el exón 3 o con otros exones del gen Silvia
Jiménez Morales 30 AML1 ( 59-62).
Aunque tanto el gen TEL como el gen AML1 se encuentran fusionados con muchos otros
genes que codifican para cinasas o factores de transcripción en leucemias de linaje mieloide
o linfoide, la fusión génica TEL-AML1, parece ser exclusiva de LAL de progenitores B. Las
bases de esta selectividad aún se desconocen, pero este hecho sugiere que la proteína
quimérica esta implicada en la proliferación y/o sobrevivencia de los precursores de células
B ( 59-62).
A pesar de que se ha identificado a los genes involucrados en la t(12;21), la función de la
proteína TEL-AML1 y AML1-TEL en la transformación maligna de las células
hematopoyéticas también se desconoce, su estructura, dada por la fusión del dominio de
oligomerización (HLH) de TEL con el dominio de transactivación de la proteína AML1,
incluyendo al dominio homólogo a RUNT, sugiere que la proteína quimérica no sólo
retiene la habilidad de unirse a secuencias del DNA y de formar un complejo con la
proteína CBFb, sino que también mantiene la función de formar homodímeros con la
proteína TEL normal mediante el dominio HLH; de esta manera, tanto la función de TEL
como la de AML1 se modifica. De acuerdo con esta hipótesis, TEL-AML1 puede reprimir
directamente la activación transcripcional de los promotores de los receptores de células T
(TCR) e IL-3 al interactuar con los sitios de unión de AML1 ( 59-62).
Es interesante que en la mayoría de los casos de LAL con la t(12;21), el alelo no
translocado de TEL, frecuentemente está deletado. La pérdida de heterocigocidad del locus
TEL, es común en niños con LAL, lo cual podría ser un evento secundario en leucemias con
ésta translocación (59-62).
FIGURA No. 10: REPRESENTACIÓN ESQUEMÁTICA DE LA FUSIÓN GÉNICA
TEL-AML1
A. Estructura intrón-exón de los genes TEL y AML1 involucrados en la t(12;21). B. Diagrama del
transcrito quimérico TEL-AML1.
Fuente: Leukemia Van Dongen y col. 1999.
I. REORDENACIÓN DEL GEN MLL
El gen MLL se localiza en el cromosoma 11 en la banda q23. La ALL infantil tiene
alta incidencia de reordenaciones 11q23 (43% al 60%), siendo la principal translocación
asociada t(4;11) (q21;q23) que ocurre en un 2% en pacientes pediátricos con ALL y en un
3-5% en pacientes adultos con ALL. También se encuentra reordenado en leucemias
mieloides agudas (AML), principalmente M4 y M5. Estudios anteriores han demostrado
que esta alteración confiere muy mal pronóstico (Figura 9). . Los pacientes que presentan
esta alteración tienen rasgos más agresivos y una alta probabilidad de fallo de los
protocolos de quimioterapia estándares. Esta asociado con inmunofenotipo : HLA-DR+,
CD34+, CD10+ y CD19+ (24-27).
El gen MLL localizado en la región 11q23 forma un transcrito de fusión con el gen
AF4 localizado en el cromosoma 4 en la región q21 ( 24-27).
Se ha estudiado la presencia de este transcrito por RT-PCR, y se encontró en
pacientes en remisión post- trasplante de médula ósea, lo que indica que podría ser un
marcador de utilidad para el seguimiento de la enfermedad así como para el estudio de
enfermedad mínima residual (Ver figura No. 11) (24-27).
FIGURA No. 11: CURVA DE EVENTOS SOBREVIVIENTES LIBRES DE
ENFERMEDAD
Se muestra menor supervivencia en los pacientes que poseen el gen MLL reordenado.
Fuente: Blood, Hilden JM. (1995)
Uno de los puntos de quiebre cromosómico más frecuentes en las leucemias humanas se
ubica en el cromosoma 11 banda q23, donde reside el gen de Linaje Leucémico Mixto
(Mixed Lineage Leukemia o MLL, también llamado ALL-1 o HRX), el cual constituye una
de las excepciones dentro de las asociaciones específicas; se ha descrito su presencia en
más de 60 genes fusionados, por lo que se dice que es un oncogen “promiscuo”. Estas
translocaciones se pueden observar en una amplia gama de patologías malignas
hematológicas, principalmente en LLA y LMA, así como también en síndromes
mielodisplásicos
y
en
el
linfoma
de
Burkitt
(4,
5).
Los rearreglos del gen MLL, que determinan distinto pronóstico terapéutico según el
fenotipo de leucemia, se detectan en 6% de los casos de LLA y 80% de éstos ocurren en
menores de un año de edad (leucemia del lactante). Su presencia constituye un factor de
mal pronóstico, que empeora en relación inversa con la edad del paciente. En la LMA son
más frecuentes: se ven en14 % de los casos totales y en 65% de los casos en lactantes y
confieren un pronóstico de riesgo intermedio (4, 5).
Estructura del gen MLL
El gen MLL se ubica en el cromosoma 11q23, justo después del dominio represor; tiene
una extensión de 90 kb y se compone de 38 exones; produce un mRNA de 12 kb que
codifica una proteína de 3969 aminoácidos, de 430 kDa de peso molecular y compleja
estructura. Esta proteína se expresaría ampliamente en el embrión en desarrollo, donde
funcionaría como regulador de la transcripción nuclear; en tejidos adultos sus niveles son
mínimos (5-7).
La proteína MLL normalmente es clivada en el citoplasma por la caspasa 1 en los
aminoácidos 2666 (sitio de clivaje 1 o CS1) y 2718 (sitio de clivaje 2 o CS2), generando
dos subunidades: MLL-N (300 kDa) y MLL-C (180 kDa). Su función es acetilar,
desacetilar y metilar las histonas de los nucleosomas (8). La proteína madura contiene una
región cluster de puntos de quiebre entre los exones 5-11 de 8,3 kb, y en su estructura se ha
identificado múltiples dominios proteicos: ganchos AT, un dominio de ADN
metiltransferasa (transcriptional repression domain, TRD), un dominio PHD (Plant
homology domain), un dominio activador de la transcripción (TA) y un dominio SET o Su
(var)3-9, enchancer-of-zeste, trithorax (7) (Figura 1).
Las alteraciones en el gen MLL incluyen deleciones, duplicaciones, inversiones y
translocaciones recíprocas; en estas últimas se generan proteínas de fusión por la
interacción con otros genes, denominados fusion partner genes (FPGs), reemplazando así
los dominios de represión transcripcional y de señalización nuclear ubicados en el extremo
N-terminal de la proteína MLL, por los extremos C-terminales de los genes de fusión. Los
puntos de quiebre que se observan en las leucemias de novo se concentran en la región
centromérica, mientras que en las leucemias del lactante y secundarias a tratamiento lo
hacen en la región telomérica (5-7). Los genes de fusión más frecuentes son: 9p 21-22 (t
9;11) en MLL-AF9, 4q21 (t 4;11) en MLL-AF4 y 19p13 (t 11;19) en MLL-ENL. MLLAF4 se ve con mayor frecuencia en LLA, MLL-AF9 es más frecuente en LMA y MLLENL es común en ambos tipos de leucemia (Ver figura No.13) (8).
FIGURA NO. 13: GEN MLL Y SU FUSIÓN CON OTROS GENES
Fuente: Nature Reviews, Cancer.
J. REORDENACIÓN E2A-PBX1
La t(1;19)(q23;p13) se encuentra en aproximadamente 5% de ALL FAB L1/L2.
Esta asociada frecuentemente a fenotipo celular de la serie B CD9+, CD10+, CD19+,
CD22+ y CD34+ (29-31).
Esta translocación forma un gen quimérico entre el gen E2A que se encuentra en el
cromosoma 19 y el gen PBX1 que se encuentra en el cromosoma 1. Los puntos de rotura en
el gen E2A ocurren de manera invariable en un espacio de 3.5 kb en el intrón que se
encuentra entre el exón 13 y el exón 14. La organización genómica del gen PBX1 todavía
no ha sido conocida por completo, pero se piensa que los puntos de rotura ocurren dentro
de un mismo intrón (29-31).
Los pacientes con esta alteración parecen ser más susceptible a una recaída. Por
numerosos estudios se ha concluido que esta alteración confiere muy mal pronóstico, el
cual puede ser mitigado por una quimioterapia muy agresiva (29-31).
La fusión génica E2A-PBX1
En la LLA, el gen E2A participa principalmente en dos eventos de fusión. El primero
resulta de la translocación cromosómica t(1;19)(q23;p13.3) y el segundo es la t(17;19) (
Ver figura No. 14) (63).
El locus genético de E2A [localizado en el cromosoma 19(q13.3)] codifica para tres
proteínas reguladoras de transcripción generados por splicing: E12, E47 y E2-5, que
pertenecen a la familia bHLH (hélice-asa-hélice). El dominio bHLH, característico de esta
familia, está constituido por una región básica, responsable de la unión específica al DNA y
un dominio estructural formado por dos hélices anfipáticas que se separan por una asa de
longitud variable. El dominio bHLH es necesario para la dimerización. La unión de E2A al
DNA se realiza mediante la formación de homodímeros o heterodímeros con proteínas
bHLH. Sin embargo la secuencia de E2A que esta incluida en las fusiones proteicas de la
leucemia, se localiza en la región NH2-terminal, la cual contiene dos dominios de
activación transcripcional denominados AD1 y AD2 (63).
Las proteínas E2A, están presentes en diferentes tejidos y pueden formar heterodimeros con
una gran variedad de proteínas bHLH tejidoespecíficas (incluyendo factores miogénicos y
neurogénicos) para coordinar la expresión de genes durante el desarrollo. En linfocitos B,
E2A funciona principalmente como un complejo homodimérico que se une a cajas E1 de
los elementos enhancer y promotores de las Igs, por lo tanto E2A y E47 son considerados
como candidatos que regulan la activación del loci Ig y el desarrollo de células B (63).
El papel de las proteínas E2A en el desarrollo de las células B, también ha sido observado
en ratones mutantes. Los ratones que tienen proteínas E2A no funcionales, detienen el
desarrollo de las células B, principalmente en estadios tempranos y muestran anormalidades
en la diferenciación de las células T, lo que sugiere que la pérdida de la función de E2A
puede contribuir a la génesis de la leucemia (63).
El gen PBX1 de 1.8 Kb, se localiza en la banda 1q23 y está formado por 8 exones.
Mediante “splicing” alternativo, PBX1 codifica para dos proteínas que difieren en la región
COOH-terminal, PBX1a y PBX1b. Estas proteínas se detectan en todos los tejidos, excepto
en células de linaje B y T (63).
La fusión del gen E2A (19p13.3) con el gen PBX1 (1;q23) en la t(1;19) que crea al gen
quimérico E2A-PBX1 es una translocación específica de la LAL pre-B. En esta
translocación, el sitio de ruptura y fusión del gen E2A ocurre en una región de
aproximadamente 3.5 kb del intrón 13 (Fig. 8), por lo que la región que se fusiona a PBX1
incluye la región codificadora de los dominios transcripcionales (AD1 y AD2), pero no la
del dominio bHLH. De tal forma que la proteína quimérica resultante contiene la región
que codifica para el dominio de transactivación transcripcional de la proteína E2A y el
dominio de unión al DNA de PBX1. El segmento que aporta PBX1 a la quimera E2APBX1 es un homeodominio de 60 aminoácidos que aumenta la capacidad de la quimera
resultante para actuar como un factor de transcripción (63).
Aunque se desconocen muchos de los mecanismos de oncogénesis de la proteína E2APBX1 en la leucemia, las evidencias experimentales sugieren que la translocación causa
una sobreexpresión de PBX1 en las células
linfoides, permitiendo así una mayor
interacción de la proteína PBX1 con otras proteínas que se unen a secuencias específicas
del DNA, lo que puede generar un aumento en la transcripción de genes blanco (63).
La translocación cromosómica t(1:19) (q23;p13.3) se detecta en aproximadamente el 5% de
todos los casos de LAL (Carroll y cols., 1984), y en el 20-25% de los casos de LAL de
células pre-B cIg+. La t(1;19) es más frecuente entre pacientes no caucásicos, los cuales
generalmente presentan mal pronóstico (63).
FIGURA No. 14: REPRESENTACIÓN ESQUEMÁTICA DE LA FUSIÓN GÉNICA
E2A-PBX1
A. Cariotipo de t(1;19). B. Estructura intrón-exón de los genes E2A y PBX1
C. Diagrama del transcrito quimérico E2A-PBX1
Fuente: Leukemia, Van Dongen y cols. 1999.
K. IMPLICACIONES PARA EL PRONÓSTICO Y TRATAMIENTO.
Por mucho tiempo y aún en la actualidad, las características clínicas y citomorfológicas de
las células leucémicas son parámetros muy importantes en el diagnóstico de esta patología
y han sido muy utilizadas para orientar el diseño de los esquemas terapéuticos y para
mantener el control de la enfermedad.
La masa inicial de células leucémicas, reflejada por el recuento leucocitario, la presencia de
enfermedad extramedular y la edad son quizá los factores pronósticos más importantes que
muestran una relación lineal con las probabilidades de sobrevida libre de enfermedad
(SLE). Los niños mayores de 10 años de edad y los que tienen recuentos leucocitarios de
más de 50x109/L tienen peor pronóstico que los de menor edad y con un recuento de
leucocitos de <50x109/L. En los adolescentes, la LLA se presenta generalmente en varones
y se caracteriza principalmente por la presencia de un recuento leucocitario elevado y
tumoración en mediastino. Estos pacientes con
frecuencia desarrollan una leucemia de células T, de tipo L2, CD10- y con características
citogenéticas desfavorables (64).
Con respecto al inmunofenotipo, los casos pre-B temprana son los que muestran una peor
respuesta al tratamiento. La positividad CD10 confiere un pronóstico más favorable y es
independiente en el caso de células T. Las LLA de células B, que antes se asociaba con un
pronóstico extraordinariamente malo, tienen ahora un mayor índice de sobrevida a largo
plazo (hasta de 80%) si se utiliza una terapia muy agresiva pero a corto plazo (2-6 meses).
La afección al SNC continúa siendo un problema grave durante el tratamiento de cualquier
tipo de leucemia, por lo que es considerada como un indicador de mal pronóstico ( Ver
tabla No. 3) (64).
En los últimos años, la biología molecular ha tenido un gran impacto en el tratamiento de la
leucemia. De acuerdo con las alteraciones moleculares se valora el riesgo de recaída y el
tratamiento está dirigido a mejorar los resultados cuando este es alto y a disminuir los
efectos colaterales cuando es bajo. De tal forma que los pacientes de bajo riesgo son
tratados con terapias menos agresivas, mientras que los tratamientos más agresivos y
tóxicos están reservados para los pacientes de alto riesgo de recaída. En la última década,
con la identificación de las anormalidades genéticas asociadas al pronóstico se ha logrado
establecer una mejor clasificación de riesgo de los pacientes. Por ejemplo, la presencia del
transcrito quimérico BCR-ABL en los pacientes con LLA, está asociado a una mal
pronóstico y pobre respuesta al tratamiento aún con quimioterapia agresiva. La mayoría de
los pacientes portadores de esta alteración genética, son niños mayores de 10 años, con una
alto recuento de linfoblastos y generalmente presentan infiltración al SNC al momento del
diagnóstico. Estos pacientes son Silvia Jiménez Morales 34 candidatos para terapias más
innovadoras, transplante de médula ósea durante la primera remisión o inmunoterapia, pero
a pesar de ello, el pronóstico es todavía muy pobre, comparado con los pacientes que no
expresan a este gen quimérico. Se estima que la SLE en estos pacientes a 5 años es menor
del 50% . Por otro lado, los pacientes portadores de la fusión génica E2A-PBX1 tienen mala
respuesta a tratamientos no intensivos con una probabilidad de sobrevida aproximadamente
del 50%, la cual incrementa hasta en un 80% cuando los pacientes son tratados con una
quimioterapia más agresiva (51, 61).
Evidencias recientes, sugieren que algunas translocaciones específicas pueden estar
asociadas con un aumento en la SLE. Por ejemplo, se ha observado que los pacientes
portadores de la t(12;21), tienen un pronóstico más favorable con tratamientos basados en
antimetabolitos (una SLE de más del 90% a 5 años). Además, diversos estudios han
mostrado que la t(12;21) es un marcador pronóstico independiente de otros factores de
riesgo como son la edad y el recuento leucocitario (51,61).
Además de sus implicaciones en el pronóstico, la caracterización de las anormalidades
genéticas descritas anteriormente, permiten detectar la enfermedad mínima residual (EMR:
niveles bajos de la enfermedad en pacientes que tienen remisión clínica y morfológica). En
general la persistencia o el incremento de la EMR detectable por RT-PCR después de un
transplante de médula ósea, está correlacionado con una subsecuente recaída. Por lo tanto el
uso de herramientas moleculares puede también ser usado para la detección de
translocaciones crípticas y monitorear la EMR y potencialmente prevenir la recaída en estos
pacientes (51,61).
TABLA No. 3: CARACTERÍSTICAS CON VALOR EN EL PRONÓSTICO DE
LEUCEMIA LINFOBLÁSTICA AGUDA
Fuente: Silvia Morales, Tesis Maestría en Biología. Universidad Metropolitana de México
PARTE III
III.
RESULTADOS
A todas las muestras analizadas, se les corrió inicialmente un gen control ABL, el cual se
utilizó para evaluar la calidad del ADN y la eficacia de la extracción ( Ver Figura No. 15).
FIGURA NO. 15: AMPLIFICACIÓN DEL GEN CONTROL ABL
Se observa la banda amplificación del gen control ABL, comprobándose la buena calidad del cDNA
de todas las muestras.
Fuente: FODECYT 48-2009.
Se analizaron un total de 143 pacientes para los cuatro transcritos propuestos: BCR-ABL,
MLL-AF4, E2A-PBX1 Y ETV6-AML1, En la tabla No. 4, se observan los resultados
obtenidos por cada una de las muestras analizadas para los cuatro transcritos.
TABLA No. 4: RESULTADOS DEL ANÁLISIS DE LOS CUATRO TRANSCRITOS
EN TODOS LOS PACIENTES.
Paciente
LLA-001
LLA-002
LLA-003
LLA-004
LLA-005
LLA-006
LLA-007
LLA-008
LLA-009
LLA-010
LLA-011
LLA-012
LLA-013
LLA-014
LLA-015
LLA-016
LLA-017
LLA-018
LLA-019
LLA-020
LLA -021
LLA-022
LLA-023
LLA-024
LLA-025
LLA-026
LLA-027
LLA-028
LLA-029
LLA-030
LLA-031
LLA-032
LLA-033
LLA-034
LLA-035
LLA-036
LLA-037
LLA-038
LLA-039
LLA-040
LLA-041
LLA-042
LLA-043
BCR-ABL
Positivo
e1:a2
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
b2:a2
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Positivo
Negativo
Negativo
Pendiente*
Pendiente*
Positivo
Positivo
Negativo
Negativo
Transcrito Quimérico
MLL-AF4
E2A-PBX1
ETV6-AML1
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente *
Pendiente *
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente*
Pendiente*
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Pendiente*
Pendiente*
Negativo
Negativo
Negativo
Negativo
LLA-044
Paciente
LLA-045
LLA-046
LLA-047
LLA-048
LLA-049
LLA-050
LLA-051
LLA-052
LLA-053
LLA-054
LLA-055
LLA-056
LLA-057
LLA-058
LLA-059
LLA-060
LLA-061
LLA-062
LLA-063
LLA-064
LLA-065
LLA-066
LLA-067
LLA-068
LLA-069
LLA-070
LLA-071
LLA-072
LLA-073
LLA-074
LLA-075
LLA-076
LLA-077
LLA-078
LLA-079
LLA-080
LLA-081
LLA-082
LLA-083
LLA-084
LLA-085
LLA-086
LLA-087
LLA-088
LLA-089
LLA-090
LLA-091
LLA-092
LLA-093
LLA-094
Negativo
BCR-ABL
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Transcrito Quimérico
MLL-AF4
E2A-PBX1
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
ETV6-AML1
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
LLA-095
LLA-096
LLA-097
LLA-098
LLA-099
LLA-100
LLA-101
LLA-102
LLA-103
LLA-104
LLA-105
LLA-106
LLA-107
LLA-108
LLA-109
LLA-110
LLA-111
LLA-112
LLA-113
LLA-114
LLA-115
LLA-116
LLA-117
LLA-118
LLA-119
LLA-120
LLA-121
LLA-122
LLA-123
LLA-124
LLA-125
LLA-126
LLA-127
LLA-128
LLA-129
LLA-130
LLA-131
LLA-132
LLA-133
LLA-134
LLA-135
LLA-136
LLA-137
LLA-138
LLA-139
LLA-140
LLA-141
LLA-142
LLA-143
Negativo
Negativo
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Anulada(LMA)
Positivo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Fuente: FODECYT 48-2009
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Anulada
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Anulada
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Anulada
Negativo
Negativo
Negativo
Negativo
Negativo
Positivo
Negativo
Pendiente
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Negativo
Según se observa el tabla No. 5; el transcrito BCR-ABL es el de mayor incidencia,
encontrándose en un 7 %, este porcentaje corresponde al reportado en otros países. Por
otro lado se observa un 4.5 % del marcador ETV6-AML1, el cual es un marcador de buen
pronóstico, y este a diferencia de los países desarrollados se encuentra más bajo; ya que en
estos países la incidencia es de aproximadamente un 20%; este transcrito es el único en el
que se ha encontrado en Guatemala una gran diferencia, y de hecho correspondería mal
pronóstico no tener tantos ETV6-AML1, ya que es un marcador de buen pronóstico. Y del
marcador E2A-PBX1, se ha encontrado tres pacientes positivos, que corresponde a un 3%
del total de pacientes analizados ( Ver figuras 16-22).
TABLA No. 5: INCIDENCIA DE CADA UNOS DE LOS TRANSCRITOS
TRANSCRITO
CANTIDAD
PORCENTAJE
DE
DE
POSITIVOS
INCIDENCIA
BCR-ABL
10
7 %
ETV6-AML1
6
4.5 %
E2A-PBX1
3
2 %
MLL-AF4
0
0%
NEGATIVOS
124
87 %
Fuente: FODECYT 48-2009
FIGURA No. 16: TRANSCRITO BCR-ABL; PACIENTES 1 Y 7
Fuente: FODECYT 48-2009
FIGURA No. 17: TRANSCRITO BCR-ABL; PACIENTES 24, 32 Y 35
Fuente: FODECYT 48-2009
FIGURA No. 18: TRANSCRITO BCR-ABL; PACIENTES 40,41 Y 97
Fuente: FODECYT 48-2009
FIGURA No. 19: TRANSCRITO BCR-ABL; PACIENTES 121 y 123
Fuente: FODECYT 48-2009
FIGURA No. 20: TRANSCRITO ETV6-AML1; PACIENTES 27, 120 Y 128.
Fuente: FODECYT 48-2009
FIGURA No. 21: TRANSCRITO ETV6-AML1; PACIENTES 27 y 32
Fuente: FODECYT 48-2009
FIGURA No. 21: TRANSCRITO ETV6-AML1; PACIENTES 59
Fuente: FODECYT 48-2009
FIGURA No. 22: TRANSCRITO E2A-PBX1; PACIENTES 20, 43 y 47
Fuente: FODECYT 48-2009
En la tabla No. 6, se observa el pronóstico y recomendación de tratamiento que se brindó a
cada paciente con algún transcrito positivo. En el caso de BCR-ABL, se orientó a mal
pronóstico a diez pacientes, y además se les recomendó transplante de médula ósea en
combinación con quimioterapia intensa. A tres pacientes positivos para E2A-PBX1, se les
orientó a mal pronóstico y a quimioterapia más agresiva. Y por último a 6 pacientes ETV6AML1 positivo se les orientó a buen pronóstico.
TABLA No. 6: PRONÓSTICO Y ORIENTACIÓN A TRATAMIENTO DE LOS
TRANSCRITOS ENCONTRADOS EN LOS PACIENTES
CANTIDAD
ALTERACIÓN
PACIENTES
GENÉTICA
10
BCR-ABL
PRONÓSTICO
TRATAMIENTO
RECOMENDADO
Muy
mal Quimioterapia muy agresiva y en
pronóstico
combinación
con
imatinib
y
transplante de médula ósea, si es
posible
3
E2A-PBX1
Mal pronóstico
Se recomienda la utilización de
quimioterapias más agresivas para
combatir esta leucemia
6
ETV6-AML1
Buen pronóstico
Se recomienda la utilización de
quimioterapias
estándar
para
alcanzar la remisión completa.
Fuente: FODECYT 48-2009
Por otro lado se obtuvo la procedencia de cada uno de los pacientes analizados ( Ver Tabla
No. 7 y 8) en el presente proyecto, con el fin de correlacionar si existe una mayor
incidencia de LLA en alguna región de Guatemala, y se observó que el mayor número de
casos corresponde a la región de occidente y del departamento de Guatemala; este dato es
muy interesante por lo que ha servido de base para el inicio de otro proyecto de
investigación, que será de evaluar los factores de riesgo asociados a leucemia en la región
occidente y centro del país.
TABLA No. 7: PACIENTES CON LLA DISTRIBUIDOS POR MUNICIPIO DE
GUATEMALA
Paciente
LLA-001
LLA-002
LLA-003
LLA-004
LLA-005
LLA-006
LLA-007
LLA-008
LLA-009
LLA-010
LLA-011
LLA-012
LLA-013
LLA-014
LLA-015
LLA-016
LLA-017
LLA-018
LLA-019
LLA-020
LLA-021
LLA-022
LLA-023
LLA-024
LLA-025
LLA-026
LLA-027
LLA-028
LLA-029
Departamento/Muncipio
San Andrés, Sololá
Huehuetenango
Quiché
Pajapita, San Marcos
Guatemala
Guatemala
Quiché
Guatemala
Puerto Barrios, Izabal
Quetzaltenango
San Ixnam, Totonicapán
Mixco, Guatemala
Jutiapa
San Juan Ostuncalco, Quetzaltenango
Suchitepequez
Guatemala
San Marcos
Jalapa
Suchitepequez
Santa Rosa
Amantitlán,Guatemala
Rethalhuleu
Petén
Huehuetenango
Guatemala
Guatemala
Quetzaltenango
Suchitepequez
Sanarate, el Progreso
Paciente
LLA-030
LLA-031
LLA-032
LLA-033
LLA-034
LLA-035
LLA-036
LLA-037
LLA-038
LLA-039
LLA-040
LLA-041
LLA-042
LLA-043
LLA-044
LLA-045
LLA-046
LLA-047
LLA-048
LLA-049
LLA-050
LLA-051
LLA-052
LLA-053
LLA-054
LLA-055
LLA-056
LLA-057
LLA-058
LLA-059
LLA-060
LLA-061
LLA-062
LLA-063
LLA-064
LLA-065
LLA-066
LLA-067
LLA-068
LLA-069
LLA-070
LLA-071
LLA-072
LLA-073
Departamento/Muncipio
Sololá
Progreso
Coatepeque, Quetzaltenango
Guatemala
Guatemala
Huehuetenango
Santa Lucía
Chimaltenango
Chimaltenango
---------------*
Sacatepéquez
Guatemala
Sacatepéquez
Jalapa
Quiché
Jutiapa
Amatitlán,Guatemala
------------------------------Huehuetenango
Huehuetenango
Quiché
Quetzaltenango
Guatemala
Guatemala
-------------------------Amatitlán,Guatemala
-----------Petén
Suchitepéquez
San Marcos
Sacatepéquez
Jutiapa
Quiché
-------------------------------Santa Rosa
Huehuetenango
Villa Canales,Guatemala
Guatemala
Chimaltenango
Quiché
Paciente
LLA-074
LLA-075
LLA-076
LLA-077
LLA-078
LLA-079
LLA-080
LLA-081
LLA-082
LLA-083
LLA-084
LLA-085
LLA-086
LLA-087
LLA-088
LLA-089
LLA-091
LLA-092
LLA-093
LLA-094
LLA-095
LLA-096
LLA-097
LLA-098
LLA-099
LLA-100
LLA-101
LLA-102
LLA-103
LLA-104
LLA-105
LLA-106
LLA-107
LLA-108
LLA-109
LLA-110
LLA-111
LLA-112
LLA-113
LLA-114
LLA-115
LLA-116
LLA-117
LLA-118
Departamento/Muncipio
Antigua Guatemala, Sacatepéquez
San Pedro Sacatepéquez
Guatemala
Guatemala
----------------Antigua Guatemala, Sacatepéquez
San Pedro Sacatepéquez San Marcos
-------------------------------Tectitlán
Quiché
Guatemala
Belice
-----------Quiché
Sta. Lucía Cotz. Escuintla
Guatemala
Amatitlán, Guatemala
San Juan Alotenango
---------------Chinautla, Guatemala
San Marcos
Suchitepéquez
San Marcos
San Marcos
Guatemala
Sololá
San Marcos
Sta. Rosa
----------------Malacatán, San Marcos
----------------Jutiapa
Quetzaltenango
Jacaltenango
San Marcos
Quiché
Escuintla
San Marcos
Pendiente
Pendiente
Amatitlán,Guatemala
Escuintla
Sanarate,El Progreso
Paciente
LLA-119
LLA-120
LLA-121
LLA-122
LLA-123
LLA-124
LLA-125
LLA-126
LLA-127
LLA-128
LLA-129
LLA-130
LLA-131
LLA-132
LLA-133
LLA-134
LLA-135
LLA-136
LLA-137
LLA-138
LLA-139
LLA-140
LLA-141
LLA-142
LLA-143
Departamento/Muncipio
Rethalhuleu
Guatemala
Chimaltenango
Anulada
Totonicapán
Pendiente
San Benito, Petén
Momostenango,Totonicapán
Escuintla
San Pedro Ayampuc,Guatemala
Quetzaltenango
Guatemala
Pendiente
Guatemala
Guatemala
Cobán, Alta Verapaz
Momostenango,Totonicapán
Quiché
Villa Nueva,Guatemala
Alta Verapaz
Guatemala
Guatemala
Jutiapa
Chiquimula
Guatemala
Fuente: FODECYT 48-2009
Tabla No 8: CANTIDAD DE PACIENTES ORGANIZADOS POR REGION
REGIONES
DEPARTAMENTO
NUMERO DE PACIENTES
DIAGNOSTICADOS
OCCIDENTE
HUEHUETENANGO
6
QUICHE
10
SAN MARCOS
SOLOLA
11
4
QUETZALTENANGO
7
TOTONICAPAN
4
TOTAL
42
1
NORTE
IZABAL
3
PETÉN
TOTAL
CENTRO
GUATEMALA , SA
CATEPEQUEZ,
CHIMALTENANGO
SUR
RETALHULEU
4
45
2
5
SUCHITEPEQUEZ
3
SANTA ROSA
ESCUINTLA
ORIENTE
5
TOTAL
15
JUTIAPA
6
3
EL PROGRESO
2
JALAPA
TOTAL
Sin clasificar
Fuente: FODECYT 48-2009
11
24
Con el objetivo de validar los resultados positivos obtenidos se escogieron cuatro pacientes
para enviar a secuenciar el ADN, y luego correlacionar la secuencia con los transcritos
estudiados. Los pacientes que se enviaron para secuenciación son No. 40, 41, 43 y 97.
A. PACIENTE No.97: POSITIVO PARA EL TRANSCRITO B2A2 DE BCRABL
A.1 SECUENCIACIÓN DEL FRAGMENTO: BCR-ABL1 F2
A.II. SECUENCIA OBTENIDA:
GGGGTCATTTTCCTGGGTCCAGCGAGAAGGTTTTCCTTGGAGTTCCAACGAG
CGGCTTCACTCAGACCCTGAGGCTCAAAGTCAGATGCTACTGGCCGCTGAA
GGGCTTCTGCGTCTCCATGGAAGGCGCCCTCGCCATCGTTGGGCCAGATCN
NN
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 23, en donde la secuencia corresponde a dos fragmentos de dos genes
distintos. Y en la figura No. 24 se puede observar que las secuencias corresponden al
cromosoma 9 y cromosoma 22 respectivamente con una identidad que se encuentra en 99100%
FIGURA No. 23: RESULTADO DE ALINEACIÓN DE SECUENCIA DE ADN
OBTENIDA, PACIENTE No. 97
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 24: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 97
Fuente: Análisis bioinformático realizado en NCBI.
En la figura No. 25: se observa la alineación que se da entre la secuencia obtenida del
paciente ( query) y la secuencia del cromosoma 9 que es complementaria; se puede
observar claramente que la secuencia es complementaria con el un fragmento del gen ABL.
FIGURA No. 25: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
ABL, PACIENTE No. 97
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 26 se observa la alineación de la secuencia analizada (query) con el gen
BCR del cromosoma 22.
FIGURA No. 26: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
BCR, PACIENTE No. 97
Fuente: Análisis bioinformático realizado en NCBI
A.III
SECUENCIACIÓN DEL FRAGMENTO BCR-ABL2 BCR-ABLf2
A.IV
SECUENCIA OBTENIDA:
GGGGTCATTTTCNCTGGGTCCAGCGAGAAGGTTTTCCTTGGAGTTCCAACGA
GCGGCTTCACTCAGACCCTGAGGCTCAAAGTCAGATGCTACTGGCCGCTGA
AGGGCTTCTGCGTCTCCATGGAAGGCGCCCTCGCCATCGTTGGGCCAGATCT
A
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 27, en donde la secuencia corresponde a dos fragmentos de dos genes
distintos. Y en la figura No. 28 se puede observar que la secuencias corresponden al
cromosoma 9 y cromosoma 22 respectivamente con una identidad que se encuentra en 99100%
FIGURA No. 27: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
97 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 28: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 97 (2)
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 29: se observa la alineación que se da entre la secuencia obtenida del
paciente ( query) y la secuencia del cromosoma 9 que es complementaria; se puede
observar claramente que la secuencia es complementaria con el un fragmento del gen ABL.
En la figura No. 30 se observa la alineación de la secuencia analizada (query) con el gen
BCR del cromosoma 22.
FIGURA No. 29: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
ABL, PACIENTE No. 97 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 30: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
BCR, PACIENTE No. 97 (2)
Fuente: Análisis bioinformático realizado en NCBI
En base a los resultados obtenidos en la página del NCBI, mostrados anteriormente se
puede concluir que el producto de la secuenciación del paciente No. 97 corresponde a un
fragmento del gen ABL y un fragmento del gen BCR; confirmándose la presencia del
transcrito BCR-ABL, que se obtuvo positivo por PCR.
B. PACIENTE No. 43: POSITIVO PARA EL TRANSCRITO E2A-PBX1
B.1 SECUENCIA DEL TRANSCRITO E2A-PBX1 ( PRIMER FOWARD)
GTCTCGGCCTCCGACTCCTACAGTGTTTTGAGTATCCGAGGAGCCCAGG
AGGAGGAACCCACAGACCCCCAGCTGATGCGGCTGGACAACATGCTGTT
AGCGGAAGGCGTGGA
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 31, en donde la secuencia corresponde a un fragmento de un gen. Y en la
figura No. 32 se puede observar que la secuencias corresponden al cromosoma con una
identidad que se encuentra en 99-100%
FIGURA No. 31: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
43
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 32: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 43
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 33, se observa la complementariedad de las secuencias analizadas con el
gen PBX1; 88 bases corresponden al Gen PBX1 del cromosoma 1.
FIGURA No. 33: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
PBX1, PACIENTE No. 43
Fuente: Análisis bioinformático realizado en NCBI
B.2 SECUENCIA DEL GEN E2A-PBX1 reverse
GTCTGTGGGTTCCTCCTCCTGGGCTCCTCGGATACTCAAAACACTGTAGGAG
TCGGGAGGCCGAGACAGGTCAGGGAGGGTGCCTGGCTGGCTGGGGAGGGC
CGCGTGGTTGTGCA
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 34, en donde la secuencia corresponde a dos fragmentos de dos genes
distintos. Y en la figura No. 35 se puede observar que la secuencias corresponden al
cromosoma 19 y cromosoma 1 respectivamente con una identidad que se encuentra en 99100%
FIGURA No. 34: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
43 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 35: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 43 (2)
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 36 se puede observar que 75 bases analizadas corresponden al gen E2A del
cromosoma 19; y en la figura No. 37 se puede observar que 42 bases corresponden al gen
PBX1 del cromosoma 1
FIGURA No. 36: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
E2A, PACIENTE No. 43 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 37: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
PBX1, PACIENTE No. 43 (2)
Fuente: Análisis bioinformático realizado en NCBI
CONCLUSION: En base a los resultados obtenidos en la página del NCBI, mostrados
anteriormente se puede concluir que el producto de la secuenciación del paciente No. 43,
corresponde a un fragmento del gen E2A y un fragmento del gen PBX1; confirmándose la
presencia del transcrito E2A-PBX1, que se obtuvo positivo por PCR.
C. PACIENTE No. 40: POSITIVO PARA EL TRANSCRITO B2A2
DE BCR-ABL
C.1 SECUENCIA BCR-ABL3-BCR-ABLF1.ab1
ATCNGACTGTCACAGCATTCCGCTGACCATCAATAAGGAAGAAGCCCTTCAGC
GGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGG
AACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTC
GTTGCACTGTATGATTTTGTGCCAGTGGAGATAA
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 38, en donde la secuencia corresponde a dos fragmentos de dos genes
distintos. Y en la figura No. 39 se puede observar que la secuencias corresponden al
cromosoma 9 y cromosoma 22 respectivamente con una identidad que se encuentra en 99100%
FIGURA No. 38: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
40
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 39: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 40
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 40 se puede observar que 155 bases de la secuencia analizada
corresponden al gen ABL del cromosoma 9 y en la figura No. 41 que 38 bases
corresponden al gen BCR del cromosoma 22
FIGURA No. 40: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
ABL1, PACIENTE No. 40
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 41: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
BCR, PACIENTE No. 40
Fuente: Análisis bioinformático realizado en NCBI
C.II SECUENCIA BCR-ABL3-BCR-ABLF2.ab1
GGGGTCATTTTCCTGGGTCCAGCGAGAAGGTTTTCCTTGGAGTTCCAAC
GAGCGGCTTCACTCAGACCCTGAGGCTCAAAGTCAGATGCTACTGGCCG
CTGAAGGGCTTCTTCCTTATTGATGGTCAGCGGAATGCTGTGGACAGTCT
GGAGTTTCACACACGAGTTGGTCAGCATCTGCAGCTCCAA
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 42, en donde la secuencia corresponde a dos fragmentos de dos genes
distintos. Y en la figura No. 43 se puede observar que la secuencias corresponden al
cromosoma 9 y cromosoma 22 respectivamente con una identidad que se encuentra en 99100%
FIGURA No. 42: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
40 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 43: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 40 (2)
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 44 se puede observara que 111 bases de la secuencia analizada
corresponden al gen ABL del cromosoma 9; y en la figura No. 45 se puede observar que 78
bases corresponden al gen BCR del cromosoma 22.
FIGURA No. 44: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
ABL, PACIENTE No. 40 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 45: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
BCR, PACIENTE No. 40 (2)
Fuente: Análisis bioinformático realizado en NCBI
CONCLUSION: En base a los resultados obtenidos en la página del NCBI, mostrados
anteriormente se puede concluir que el producto de la secuenciación del paciente No.40
corresponde a un fragmento del gen ABL y un fragmento del gen BCR; confirmándose la
presencia del transcrito BCR-ABL, que se obtuvo positivo por PCR.
D. PACIENTE No. 41: POSITIVO PARA EL TRANSCRITO E2A2
DE BCR-ABL
D.I SECUENCIA BCR-ABL4-ABL-R.ab1
CAANNTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGT
GAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTG
AAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGA
GATA
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 46, en donde la secuencia analizada corresponde a un fragmento en el
genoma. Y en la figura No. 47 se puede observar que la secuencia corresponde al
cromosoma 9 con una identidad que se encuentra en 99-100%
FIGURA No. 46: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
41
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 47: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 41
Fuente: Análisis bioinformático realizado en NCBI
En la figua No. 48 se puede observar que 147 bases de la secuencia corresponden al gen
ABL del cromosoma 9.
FIGURA No. 48: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
BCR, PACIENTE No. 41
Fuente: Análisis bioinformático realizado en NCBI
D.II SECUENCIA BCR-ABL4-BCR-ABLF2.ab1
NNGGNNNNANNNNGGGGTCATTTTCCTGGGTCCAGCGAGAAGGTTTTCC
TTGGAGTTCCAACGAGCGGCTTCACTCAGACCCTGAGGCTCAAAGTCAG
ATGCTACTGGCCGCTGAAGGGCTTCTGCGTCTCCATGGAAGGCGCCCTC
GCCATCGTTGGGCCAGATCN
El análisis del producto de secuenciación se llevó a cabó en la página del NCBI (
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION), se puede observar
en la figura No. 49, en donde la secuencia analizada corresponde a dos fragmentos distintos
en el genoma. Y en la figura No. 50 se puede observar que la secuencia corresponde al
cromosoma 9 y al 22 con una identidad que se encuentra en 99-100%
FIGURA No. 49: ALINEACIÓN DE LA SECUENCIA OBTENIDA, PACIENTE No.
41 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 50: CROMOSOMAS QUE CONTIENEN LA SECUENCIA ANALIZADA,
PACIENTE No. 41 (2)
Fuente: Análisis bioinformático realizado en NCBI
En la figura No. 51 se puede observar que 112 bases de la secuencia analizada
corresponden al gen ABL del cromosoma 9; y en la figura No. 52 se puede observar que 44
bases corresponden al gen BCR del cromosoma 22.
FIGURA No. 51: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL GEN
ABL, PACIENTE No. 41 (2)
Fuente: Análisis bioinformático realizado en NCBI
FIGURA No. 52: ALINEACIÓN DE LA SECUENCIA OBTENIDA CON EL
GEN BCR, PACIENTE No. 41 (2)
Fuente: Análisis bioinformático realizado en NCBI
III.1
DISCUSIÓN DE RESULTADOS
Se analizaron un total de 143 pacientes con diagnóstico de leucemia linfoblástica
aguda, referidos de distintos hospitales nacionales del país. Para comprobar la calidad del
cDNA, a todas las muestras se les amplificó el gen control ABL ( Ver figura No. 15).
De todos los pacientes analizados se detectaron 10 pacientes positivos para el
transcrito BCR-ABL (7%); 6 pacientes positivos para el transcrito ETV6-AML1 (4.5%), y
3 pacientes positivos para el transcrito E2A-PBX1 (2%). Y por otro lado ningún paciente
presentó el transcrito MLL-AF4. ( Ver figuras 16-22 y tabla No. 4 y 5).
El transcrito BCR-ABL, que procede de la translocación t(9;22) , es una alteración
que se ha asociado a muy mal pronóstico en pacientes con LLA; caso muy contrario es
cuando se encuentra en leucemia mieloide crónica, ya que para estos pacientes se suele
tratar exitosamente con un tratamiento molecular llamado Imatinib. Sin embargo este
tratamiento en LLA no es del todo efectivo; por lo que un paciente con LLA BCR-ABL
positivo, posee un pronóstico muy desfavorable, y deja casi como única alternativa, un
trasplante de médula ósea.
A los 10 pacientes positivos para BCR-ABL, se les informó de mal pronóstico y se
les orientó a un tratamiento más agresivo, como lo es combinación de quimioterapia con
trasplante de médula ósea. (Ver tabla No. 6)
El porcentaje encontrado en Guatemala corresponde a un 7%, lo que es muy similar
a lo encontrado en otros países desarrollados y en vías de desarrollo, en los cuales la
incidencia suele ser alrededor de un 5% (16). Esto en pacientes pediátricos, porque se sabe
que en los adultos con LLA se puede llegar a tener una incidencia hasta del 30%. Como
parte de la caracterización genética que se esta realizando mediante este proyecto en
Guatemala, se puede establecer que el transcrito BCR-ABL se encuentra un 7% en un total
de 143 pacientes analizados. (16)
El transcrito E2A-PBX1, que proviene de la translocación t(1;19); se encuentra
asociado a un mal pronóstico; no tan agresivo como BCR-ABL, pero si orienta a
tratamiento con quimioterapias más agresivas. La incidencia encontrada en Guatemala de
este transcrito es del 2%, porcentaje que no difiere considerablemente de lo reportado en
países desarrollados como en vías de desarrollo, en donde se ha reportado hasta un 5% de
incidencia ( Ver tabla No. 6) (31).
El transcrito ETV6-AML1, que procede de la t(12,21); es una alteración
considerada de buen pronóstico; ya que los pacientes que presentan este transcrito
responden muy bien a quimioterapia estándar; y poseen índices de recaídas muy bajos. Este
transcrito se encontró en un 4.5 % de frecuencia en la población guatemalteca. ( Ver Tabla
No. 6).
Existen una gran variedad de países en los cuales se ha reportado una alta incidencia
del gen de fusión ETV6-AML1: En un estudio realizado en Hong-Kong, a 67 pacientes con
leucemia linfoblástica aguda; se encontró el 17.9% del transcrito ETV6-AML1, en Taiwan,
se analizaron 433 pacientes, y se encontró un 15.8% de frecuencia del gen ETV6-AML1;
en la población Hungara se encontró un 20% de incidencia del gen ETV6-AML1; en
Alemania e Italia, se encontró una incidencia de 18.9%; en Tunisia se encontró 28% de
frecuencia de ETV6-AML1; en Brazil, se encontrado de un 19 hasta un 40% de casos
positivos para ETV6-AML1; en Costa Rica, un 18% del marcador ETV6-AML1, en China,
22.8% de pacientes positivos para ETV6-AML1 y en Malasia se reporta un 19% de frecuencia
de ETV6-AML1 (32-42).
Por otro lado hay algunos países que han reportado una baja frecuencia del gen
ETV6-AML1, por debajo del 15%. En un estudio realizado en Chile, se encontró un 13 %
del gen ETV6-AML1 (43) .
En un estudio internacional que se realizó en cuatro países en vías de desarrollo:
India, Pakistan, Myanmar y Sudan; en donde se analizaron 181 niños, se encontró una baja
incidencia el marcador ETV6-AML (7.4%). Y en este estudio se encontró un alza en dos
marcadores de mal pronóstico MLL-AF4 17% y BCR-ABL (22%) (44).
En España, se analizaron 101 casos de LLA, de los cuales todos fueron negativos
para ETV6-AML1, 38 de los 101 pacientes eran pediátricos. Estos resultados sugieren la
existencia de variaciones genéticas y de raza en el genotipo de leucemia linfoblástica aguda
(45).
En un estudio realizado en el Sur de la India, se analizaron 42 pacientes con LLA y
se encontró únicamente un 4.8% de casos positivos para ETV6-AML1; en este estudio se
concluye que la incidencia de este transcrito para la población India es menor (46)
En la tabla No. 9, se observa un resumen de la frecuencia del gen ETV6-AML1
publicada en distintas revistas internacionales; en donde se puede observar una menor
incidencia de esta alteración en la India y en España, datos que coinciden con los
encontrados en Guatemala
TABLA No. 9: FRECUENCIA DE ETV6-AML1 EN DISTINTOS PAÍSES
LOCALIZACIÓN
NUMERO
DEL ESTUDIO
PACIENTES
DE FRECUENCIA %
REFERENCIA
India
42
4.8
Hill Anita, et al.
Inglaterra
56
39
Codrington et al.
Australia
66
33
Amor et al.
Alemania/Italia
334
18.9
Borkhardt et al.
Taiwan
165
18
Liang et al.
Brazil
67
17.9
Magalhaes et al.
USA
86
17%
Jamil et al.
Taiwan
41
17
Liang et al.
Hong Kong
75
16
Tsang et al.
Suiza
72
15
Andreasson et.al.
Scotland
36
11.1
Spathas et al.
Japan
74
9.5
Eguchi-Ishimae et al.
India
46
9
Inamdar et al.
India
259
7
Siraj et al.
España
41
2
García- Sanz et al.
Fuente: Hill A, et al. (2005) Haematologica 90: 414-416
En un estudio sobre poblaciones en donde participó nuestro equipo; se analizaron
poblaciones mayas y se compararon sus polimorfismos con otras etnias. Se encontró que la
población maya tiene mayor similitud con Europa con una frecuencia alélica de 0.38, esto
se podría explicar por la conquista española. Una frecuencia alélica común con la población
africana; y con el sur y este de Asia un 0.38 de frecuencia alélica.
Si se puede observar en la tabla No. 8, las frecuencias más bajas del marcador
ETV6-AML1 se han reportado en España y en la India, la cuales coinciden con las
encontradas en Guatemala. Y Si bien es cierto se piensa que la LLA es en un 90% genética
adquirida no heredada, pareciera existir un patrón de predisposición genética según la
población; ya que España, la India y Guatemala poseen una incidencia de ETV6-AML1
extremadamente baja. Sería interesante realizar más estudios relacionados con esto (47). En
otro estudio realizado en LLA en dos tipos de poblaciones; Hispánicas y blancos no
hispánicos; también se observó que en Hispanos la frecuencia de ETV6-AML1 es de un
13%, mientras que en no hispánicos blancos es significativamente mayor, 24 %. En este
estudio fue la primera vez en la que se observó que una variación étnica afectaba la
presencia de dicho marcador.
Aunque este estudio fue realizado en Estados Unidos,
pareciera existir una menor incidencia en personas con descendencia hispánica; lo que sería
congruente con lo encontrado en Guatemala (48) Otros países que han reportado una
incidencia por debajo del 15 % son Nicaragua y Korea (49-50)
Por otro lado se analizó la distribución geográfica dentro de Guatemala, y se
encontró que más del 50% de casos provienen de la región del occidente y Centro del país;
30% de la región del Occidente y 32% de la región del Centro. Y coincide también que en
estas regiones predominaron los marcadores genéticos encontrados. ( Ver tablas No. 7 y 8)
Estos datos muestran claramente una afectación de LLA geográfica, que puede
deberse a una gran variedad de factores; como la posible existencia de una predisposición
genética, según lo analizado anteriormente con el marcador ETV6-AML1; y por otro lado
una mayor presencia de factores de riesgo asociado. Se ha empezado otro proyecto para
estudiar factores de riesgo en estos pacientes, se evaluará la presencia de agroquímicos,
contaminantes en agua, riesgos laborales, elementos y compuestos tóxicos, entre otros.
Y por último para validar la técnica estandarizada en el presente proyecto, se
enviaron a secuenciar las muestras de DNA de los siguientes pacientes: No. 40, 41, 43 y
97. De los cuales se puede concluir que todos los productos de la secuenciación coinciden
con los genes BCR-ABL y E2A-PBX1 analizados ( Ver figuras 23-52).
PARTE IV.
IV.1
CONCLUSIONES
1. De los 143 pacientes con diagnóstico de leucemia linfoblástica aguda, 19 pacientes
presentaron alguno de los cuatro transcritos de los incluidos en el estudio.
2. La estandarización de la técnica de PCR Multiplex, se realizó mediante la
utilización de líneas celulares, y secuenciación de los pacientes con transcritos
positivos.
3. En el presente estudio se encontraron, 10 pacientes positivos para el transcrito
BCR-ABL ( 7%); 6 pacientes positivos para el transcrito ETV6-AML1 (4.5%), y 3
pacientes positivos para el transcrito E2A-PBX1 (2%); y ningún paciente presentó
el transcrito MLL-AF4.
4. La baja incidencia del gen ETV6-AML1 encontrada en Guatemala, coincide con
países como España e India, con los cuales la población guatemalteca comparte más
polimorfismos genéticos.
5. La incidencia de los transcritos BCR-ABL y E2A-PBX1 encontrada en Guatemala,
es similar a lo reportado en el resto del mundo; por lo que no se encontró diferencias
debido a distinta etnia poblacional.
6. Los pacientes que presentaron los transcritos BCR-ABL y E2A-PBX1, fueron
informados sobre mal pronóstico del desarrollo de la leucemia; y por lo tanto
orientados a esquemas de terapias más agresivas, y los pacientes que presentaron el
transcrito ETV6-AML1 fueron informados de buen pronóstico, y orientados a
esquemas de terapia estándar.
7. En base a los resultados obtenidos, se ha caracterizado genéticamente por primera
vez en Guatemala, los cuatro transcritos que se asocian mundialmente a leucemia
linfoblástica aguda.
8. La divulgación del presente estudio, se ha realizado mediante la elaboración de
póster y trifoliares, repartidos en los distintos hospitales.
9. La región Occidente y Centro de Guatemala, posee más del 50% de casos de
Leucemia linfoblástica aguda y de marcadores genéticos, sugiriendo la presencia de
factores de riesgo asociados en estas regiones.
IV.2
RECOMENDACIONES
1. Estudiar la presencia de algunos otros marcadores genéticos asociados a leucemia
linfoblástica aguda como mutaciones en el gen FLT3 y p53.
2. Extender la utilización la técnica de PCR MULTIPLEX, a otros tipos de cáncer,
para un mejor manejo de la enfermedad.
3. Ampliar el estudio a un mayor número de pacientes, para comprobar si la incidencia
encontrada en el presente estudio se mantiene igual.
4. Realizar futuros proyectos que confirmen la relación ancestral de la población maya
guatemalteca, con la población de España y de la India.
5. Comprobar que los marcadores BCR-ABL y E2A-PBX1, no presentan asociación
con las variaciones en el genoma humano en distintas poblaciones.
6. Continuar con la evaluación de estos marcadores genéticos para toda la población
guatemalteca con leucemia linfoblástica aguda; para poder establecer el pronóstico
y orientar a tratamiento a todos los nuevos casos presentados en los hospitales
nacionales.
7. Caracterizar genéticamente otros tipos de cáncer, con el objetivo de conocer la
genética del cáncer en Guatemala.
8. Divulgar los resultados obtenidos a la comunidad científica internacional, mediante
una publicación en una revista científica de prestigio.
9. Analizar factores de riesgo asociados,
a la presencia de mayor leucemia
linfoblástica aguda en las regiones del Occidente y Centro de Guatemala.
IV.3
REFERENCIAS BIBLIOGRÁFICAS
1. Calazans M. (2002). Revisión de Técnicas de citogenética convencional y molecular y
su implicación en el diagnóstico y pronóstico del cáncer. España: Ediciones
Universidad de Navarra.
2. Haferlach T, Wolfgang K, Schnittger S and Schoch C (2005). Modern Diagnostics in
acute leukemias. Criticals reviews in oncology/hematology, 56, 223-234.
3. Odero M. Et al. (2007). Manual de prácticas de Genética. España: Ediciones Facultad
de Ciencias, Medicina, Universidad de Navarra.
4. Arangure, J. et al. (2005). Incidence of leukemias in children from el Salvador and
México city between 1996-2000: Population based-data. BMC Cancer, 5, 1-9.
5. Pallisgaard, N. et al. (1998). Multiplex Reverse Transcription-Polymerase Chain
Reaction for Simultaneous Screening of 29 Translocations and Chromosomal
Aberrations in Acute Leukemia. Blood, 92, 574-588.
6. Scurto, P et al. (1998). A multiplex RT-PCR assay for the detection of chimeric
transcripts encoded by the risk-stratifying translocations of pediatric acute
lymphoblastic leukemia. Leukemia, 12, 1994-2005.
7. Viehmann, S. et al. (1999). Multiplex PCR- a rapid screening method for detection of
gene rearrangements in childhood acute lymphoblastic leukemia. Ann Hematol, 78,
157-162.
8. Marin C. et al. (2001). Multiplex-polymerase chain reaction assay for the detection of
prognostically
significant
translocations
Haematologica, 86, 1254-1260.
in
acute
lymphoblastic
leukemia.
9. Cerveira, N. (2000). Detection of prognostic significant translocations in childhood
acute lymphoblastic leukaemia by one-step multiplex reverse transcription polymerase
chain reaction. Bristish Journal of Haematology, 109, 638-640.
10. Carranza C. (2007). Caracterización genética de pacientes con neoplasias mieloides y
alteraciones del brazo largo del cromosoma 3. Mecanismo de sobreeexpresión y
análisis funcional del promotor del gen EVI1. Memoria de investigación. Suficiencia
Investigadora. España: Ediciones Facultad de Ciencias, Universidad de Navarra, Centro
de Investigación Médica Aplicada. –CIMA-.
11. Perez- Vera P, Sánchez M, Carnevale A, Riva Roberto, Paredes R, Martínez A and
Frías S. (2001). Cytogenetics in acute lymphoblastic leukemia in Mexican Children:
An Institutional Experience. Archives of Medical Research. 32, 202-207.
12. Mrozek K, Heerema N and Bloomfield C. (2004). Cytogenetics in acute leukemia.
Blood Reviews. 18, 115-136.
13. Hilden J, et al. (1995). Molecular analysis in acute lymphoblastic leukemia: MLL
Rearrangement and reverse transcriptase reaction chain for t(4;11) (q21;q23). Blood,
86, 3876-3882.
14. Bose S, Deininger M, Gora J, Goldman J an Melo J. (1998).The presence of typical or
atypical BCR-ABL fusion genes in Leucocytes or normal individuals: Biological
significance and Implications for the assessment of minimal residual disease. Blood, 92,
3362-3367.
15. Deininger M, Goldman J and Melo J. (2000). The molecular biology of chronic
myeloid leukemia. Blood. 3343-3356.
16. Radich J. (1997). Detection of BCR-ABL transcripts in Philadelphia Chromosomepositive Acute Lymphoblastic leukemia after marrow transplantation. Blood , 89, 26022609.
17. Martinelli G. et al. (1998). Detection or BCR-ABL transcript chronic myelogenous
leukemia patients by reverse-transcription-polymerase chain reaction and capillary
electrophoresis. Haematologica, 593-601.
18. Melo J. et al. (1993).
The ABL-BCR fusion Gene is expressed
in Chronic
myelogenous leukemia. Blood, 81, 158-165.
19. Kaeda J. et al. (2006). Serial Measurement of BCR-ABL transcripts in the peripheral
blood after allogenic stem cell transplantation for chronic myeloid leukemia: an attempt
to define patients who may not require further therapy. Blood, 107, 4171-4176 .
20. Golub T, et al. (1995). Fusion of the Tel gene on 12p13 to the AML1 gene on 21q22 in
acute lymphoblastic leukemia. Proc. Natl. Acad. Sci. USA, 92, 4917-4921.
21. Harbott J, et al. (1997). Incidence of TEL/AML1 fusion gene analyzed consecutively in
Children acute lymphoblastic leukemia in relapse. Blood, 90, 4933-4937.
22. Zelent A. (2004). Role of TEL- AML1 fusion gene in the molecular pathogenesis of
childhood acute lymphoblastic leukemia. Oncogene, 23, 4275-4283.
23. Wiemels J. (1999). Structure and possible mechanisms of TEL-AML1 gene fusions in
Chilhood Acute Lymphoblastic Leukemia. Cancer Research, 59, 4075-4082.
24. Hilden JM. (1995). Molecular analysis of infant acute lymphoblastic leukemia: MLL
gene rearrangement and reverse transcriptase polymerase chain reaction for
t(4;11)(q21;q23). Blood, 86, 3876-3882.
25. Behm FG. Et al. (1996). Rearrangement of MLL gene confers poor prognosis in
childhood acute lymphoblastic leukemia. Blood, 2870-2877.
26. Yoshiyuki K. et al. (2004).
Infant acute lymphoblastic leukemia with MLL gene
rearrangements: outcome following intense chemotherapy and hematopoietic stem cells
transplantation. Blood, 104, 3527-3534.
27. Harper D. et al. (2008). Chromosomal rearrangements leading to MLL gene fusions:
Clinical and biological aspects. Cancer Research, 68, 10024-10027.
28. Piccaluga P. et al. (2006). Poor outcome of adult acute lymphoblastic leukemia patients
carrying the t(1;19)(q23;p13) translocations. Leukemia and lymphoma, 47, 469-472.
29. Lanza C. et al. (1996).
Persistense EA2-PBX1 transcript in t(1;19) childhood acute
lymphoblastic leukemia: correlation with chemotherapy intensity
and clinical
outcome. Leukemia research, 20, 441-443.
30. Foa R. et al. (2003).
EA2-PBX1 fusion in adult acute lymphoblastic leukemia:
biological and clinical features. British Journal of hematology, 120, 484-487.
31. Hunger Sp. (1996). Chromosomal translocations involving E2A gene in acute
lymphoblastic leukemia: clinical features and molecular pathogenesis. Blood, 87, 12111224.
32. Kam Sze, et al. (2001). TEL/AML1 Rearrangement and the Prognostic Significance in
Childhood Acute Lymphoblastic Leukemia in Hong Kong. American Journal of
Hematology, 68, 91-98.
33. Liang D, et al. (2010). Frequencies of ETV6-RUNX1 Fusion and Hyperdiploidy in
Pediatric Acute Lymphoblastic Leukemia Are Lower y Far East than West. Leukemia,
7, 23-25.
34 Laszló P, et al. (2001) INTERNATIONAL NOTE: Characteristics of TEL-AML1
Positive Acute Lymphoblastic Leukemia in Hungarian Children. Med Pediatr Oncol, , 37,
409-411.
35 Arndt B. et al. (1997). Incidence and Clinical Relevance of TEL/AML1 Fusion Genes
in Children with Acute Lymphoblastic Leukemia enrolled in the German an Italia
multicenter therapy trials. Leukemia, 90, 571-577.
36. Gmidene Abir, et al. (2009). ETV6-RUNX1 Rearrangement in Tunisian Pediatric Blineage Acute Lymphoblastic Leukemia. Advances in Hematology, 5, 30-38.
37. Magalhaes, I. (2000). TEL-AML1 Fusion gene frequency in pediatric acute
lymphoblastic leukaemia in Brazil. British Journal of Haematology, 111, 204-207.
38. Zen P. (2004). Prevalence of TEL-AML1 fusion gene in Brazilian pediatric patients
withe acute lymphoblastic leukemia. Cancer Genetics and Cytogenetics, 151, 68-72.
39. Acosta B. et al. (2004). High frecuency of t(12;21)(p13;q22) in Children with acute
lymphoblastic leukemia and known clinical outcome in southern Brazil. Leukemia, 28,
1033-1038.
40. Santamarina C. et al. ( 2009). Acute leukemia. J Pediatr Hematol Oncol, 31, 131–135.
41. Gao Yi-Jin (2007). Prevalence of ETV6-AML1 fusion gene in children with acute
lymphoblastic leukemia in China. Cancer Genetics and Cytogenetics. 178, 57-60.
42. Kaur H, et al. (2005). TEL-AML1 frecuency in multi-ethnic Malaysian pediatric acute
lymphoblastic leukemia. Cancer Genetics and Cytogenetics, 156, 129-133.
43. Artigas C, et al. (2006). Frecuencia de los genes de fusión TEL/AML1 BCR/ABL en
pacientes pediátricos con leucemia linfoblástica aguda. Blood, 134, 1367-1376.
44. Siddiqui, R. et al. (2010). Distribution of common genetic subgroups in childhood
acute lymphoblastic leukemia in four developing countries. Cancer Genetics and
Cytogenetics, 200, 149-153.
45. García Sanz, et al. (1999). Low frequency of the TEL-AML1 fusion gene in acute
lymphoblastic leukaemia in Spain. Blood, 107, 667-669.
46. Hill A, et al. (2005). The t(12;21) is underepresented in childhood B-lineage acute
lymphoblastic leukemia in Kerala, Southern India. Haematologica, 90, 414-416.
47. Nam Yang, et al. (2005). Examination of ancestry and ethnic affiliation using highly
informative diallelic DNA markers: application to diverse and admixed populations and
implications for clinical epidemiology and forensic medicine. Hum Genet, 118, 382-392.
48. Aldrich, M. et al. (2006). Cytogenetics of Hispanic and White Children with Acute
lymphoblastic Leukemia in California. Cancer Epidemiol Biomarkers Prev, 15, 578-581.
49. Ceppi, F. (2009). Cytogenetic Characterization of childhood Acute lymphoblastic
Leukemia in Nicaragua. Pediatr Blood Cancer, 53, 1238-1241.
50. Park K, et al. (2001). Low incidence of TEL-AML1 fusion and TEL deletion in Korean
childhood acute
leukemia by extra-signal fluorescence in situ hybridization. Cancer
Genetics and Cytogenetics, 126, 73-77.
51. Rubnitz JE, Look TA. (1998). Molecular genetics of childhood leukemias. J Pediatr
Hematol Oncol, 20, 1-11.
52. Head DR, Pui CH (1999). Diagnosis and classification in Pui CH (Ed). Childhood
leukemias, 20, 19-37.
53. Mesera G, Confer V, Rizzaru C, Jankovic M, Colombini A (1998). Childhood acute
lymphoblastic leukemia. Oncologia, 8, 309-317.
54. Rivera-Luna R, Leal-Leal C, Cárdenas-Cárdos R, Martínez-Avalos A, Meza Coria C,
Navarro-Alegría I, Ruano-Aguilar J. (1996). A survey of 4,076 children with cancer:
Certain epidemiological aspects from a single Institution. Bol Med Hosp Infant Méx, 53,
598-605.
55. Pérez-Vera P, Mújica-Sánchez M, Carnevale A, Rivera-Luna R, Paredes R, Martínez A,
Frías S (2001). Cytogenetics in acute lymphoblastic leukemia in mexican Children: An
Institutional experience. Archives of Medical Research, 32, 202-207.
56. Pui CH, Crist WM (1999). Acute lymphoblastic leukemia in Pui CH. Childhood
leukemias, 20, 288-312.
57. Romana SP, Poirel H, Della Valle V, Mauchauffé M, Buzón-Le MC, Berger R, Bernard
OA (1999).
Molecular analysis of chromosomal breakpoints in three examples of
chromosomal translocation involving the TEL gene. Leukemia, 13, 1754-1759.
58. Fenrick R, Wang L, Nip J, Rooney RJ, Walker-Daniels J, Crawford HC, Hulboy DL,
Knich MS, Matrisian LM, Hiebert SW (2000). TEL, a putative tumor suppresor, modulates
cell growth and cell morphology of Ras. Transformed cells while repressing the
transcription of stromelysin-1. Mol Cell Biol, 20, 5828-5839.
59. Friedman AD (1999). Leukemogenesis by CBF oncoproteins. Leukemia, 13, 19321942.
60. Romana SP, Poirel H, Della Valle V, Mauchauffé M, Buzón-Le MC, Berger R,
Bernard OA (1999). Molecular analysis of chromosomal breakpoints in three examples of
chromosomal translocation involving the TEL gene. Leukemia, 13, 1754-1759.
61-Rowley JD (1999). The role of chromosome translocations in leukemogenesis. Seminars
in Hematology, 36, 59-72.
62. Shurtleff SA, Bujis A, Behm FG, Rubnitz JE, Raimondi SC, Hancock ML, Chang GC,
Pui C, Grosveld G, Downing JR (1995). Tel/AML1 fusion resulting from a cryptic t(12;21)
in the most common genetic lesion in pediatric ALL and defines a subgroup of patients
with an excellent prognosis. Leukemia, 9, 1985-1989.
63. Hunger SP. (1996). Chromosomal translocations involving the E2A gene in acute
lymphoblastic leukemia: Clinical features and molecular pathogenesis. Blood , 4, 12111224.
64. Mesera G, Confer V, Rizzaru C, Jankovic M, Colombini A (1998). Childhood acute
lymphoblastic leukemia. Oncologia, 8, 309-317.
IV.4
ANEXOS
ANEXO NO. 1: METODOLOGÍA PARA ESTANDARIZACIÓN DE TÉCNICA DE
PCR MULTIPLEX
I.
CULTIVO DE LÍNEAS CELULARES
K-562 es la línea celular del transcrito quimérico BCR-ABL; la MV4-11 es la línea
celular del transcrito quimérico MLL-AF4 y la Reh es la línea celular del transcrito
quimérico ETV6-AML1. Estas líneas se utilizarán como control positivo para
estandarizar las técnicas. El procedimiento realizado para el cultivo de las mismas se
describe a continuación:
a. Se dividieron en dos grupos: una mitad para realizar el cultivo celular, y la otra
mitad para dejarla congelada.
b. Se descongelaron y cultivaron las líneas celulares K-562, Reh y MV4-11, con los
transcritos quiméricos BCR-ABL, ETV6-AML1, MLL-AF4 respectivamente,
siguiendo el protocolo de procedimiento de la compañía en donde se compraron las
líneas celulares. Se utilizó el medio para el cultivo con RPMI 1640, Suero fetal
bovino (SFB) y L-Glutamina. Una vez preparado el medio de cultivo se agregaron
las suspensiones celulares y se incubaron a 37°C con 5% de CO2. ( Ver figura 5356).
FIGURA No. 53: LÍNEAS CELULARES K562, REH Y MV4-11 EN HIELO SECO
Fuente FODECYT 48-2009
FIGURA No. 54: MEDIO DE CULTIVO RPMI Y SUERO FETAL BOVINO
Fuente FODECYT 48-2009
FIGURA No. 55: CULTIVO DE LÍNEAS CELULARES EN EL MEDIO DE
CULTIVO RPMI
Fuente FODECYT 48-2009
FIGURA No. 56: DISTINTOS CULTIVOS DE LÍNEAS CELURARES EN
INCUBACIÓN
Fuente FODECYT 48-2009
c. Para monitorear el crecimiento celular, se realizaron conteos de las células en el
microscopio utilizando una cámara de Newbauer (ver figura No. 57 y 58), los
resultados se pueden observar en la tabla No. 10
TABLA No. 10 CANTIDAD DE CÉLULAS DE CADA LÍNEA CELULAR POR
MILILITRO
Línea Celular Fecha
K-562
Reh
MV4-11
Hora
No. de Células por mL
10-04-2010 11:00am
58
13-04-2010 3:00pm
800
14-04-2010 9:30am
1190
16-04-2010 1:00pm
324
10-04-2010 11:00am
110
13-04-2010 3:00pm
430
16-04-2010 1:00pm
3275
10-04-2010 11:00am
520
13-04-2010 3:00pm
680
16-04-2010 1:00pm
2,300
Fuente FODECYT 48-2009
d. Se realizó el recambio de medio cada 3 días.
e. Luego de los 6 días del primer subcultivo, se realizaron subcultivos, dividiéndolos
en 2 grupos.
f. Luego de 6 días, se guardó un duplicado con el reactivo RNA Later, para mantener
las células viables para realizar extracciones posteriores.
g. El otro duplicado se utilizó para realizar la extracción de ARN.
FIGURA No. 57: OBSERVACIÓN AL MICROSCOPIO DE CULTIVOS
CELULARES
Fuente FODECYT 48-2009
FIGURA No. 58: LÍNEAS CELULARES OBSERVADAS AL MICROSCOPIO
A
Fuente FODECYT 48-2009
B
C
II.
EXTRACCIÓN DE ARNm DE LAS LÍNEAS CELULARES CULTIVADAS
Y TRANSCRIPCIÓN REVERSA (RT)
a. A partir de las células cultivadas, se realizó la extracción de ARNm siguiendo el
protocolo de procedimiento para células de mamíferos indicado por la compañía
fabricante del kit de reactivos ( ver figura No. 59).
FIGURA No. 59: FILTRO UTILIZADO PARA EXTRACCIÓN DE ARNm
Fuente FODECYT 48-2009
b. Inmediatamente se realizó la transcripción reversa, esto con el fin de obtener el
ADNc correspondiente al ARNm aislado ( ver figura No. 60).
FIGURA No. 60: PROCEDIMIENTO DE RETROTRANSCRIPCIÓN
Fuente FODECYT 48-2009
c. Se cuantificó el producto obtenido de ADNc, obteniéndose los resultados la tabla
No. 11. En este cuadro se puede observar que la cantidad obtenida de ADNc fue
bastante satisfactoria
Tabla No. 11. Concentración del ADNc
Línea Celular Pureza* Concentración [ng/µL]
K-562
Reh
MV4-11
A
2.05
1,875.00
B
2.05
2,070.00
A
2.03
1,950.00
B
2.08
1,830.00
A
2.04
1,765.00
B
2.06
1,555.00
*Un rango de pureza entre 1.8-2.0 indica una calidad aceptable
Fuente: FODECYT 48-2009
Por otro lado se realizó una prueba utilizando sangre periférica de una persona sana
X, para validar la extracción de las células mononucleares mediante la utilización de ficoll.
Esto se realizó ya que es el procedimiento que se utilizará en los pacientes evaluados para
obtener los linfocitos que posteriormente se utilizarán para extraer su ARNm ( ver figura 61
y 62).
FIGURA No. 61: SEPARACIÓN DE CÉLULAS MONONUCLEARES DE
MÉDULA ÓSEA POR MEDIO DE FICOLL
Fuente FODECYT 48-2009
FIGURA No. 62: CELULAS MONONUCLEARES EN INTERFASE, DESPUÉS DE
SEPARACIÓN CON FICOLL
Fuente FODECYT 48-2009
ANEXO No. 2
HOJA DE CONSENTIMIENTO DE PRUEBAS CITOGENÉTICAS
La leucemia Linfoblástica aguda es una neoplasia de los linfocitos que se
encuentran en la sangre. Las pruebas genéticas son técnicas que sirven de
ayuda al médico para confirmar el diagnóstico y monitorear su respuesta al
tratamiento. Para hacer estas pruebas se utilizará un poco de la muestra de
médula ósea que el médico obtendrá para realizar el diagnóstico.
Yo, ______________________________ (nombre y apellidos) con cédula de
vecindad _______________después de haber sido informado personalmente
de los procedimientos que se utilizarán para establecer el
diagnóstico del
paciente.
Autorizo que se le realicen las pruebas genéticas que el médico considere
pertinentes a mi hijo(a)
_____________________________________ .
Fecha:
___________________________________
Firma de los padres y/o responsable:
___________________________________
Firma del médico
____________________________________
Sello de la institución
HOJA DE ASENTIMIENTO
Yo, _______________________________________________ de _________años de edad.
He sido informado por el médico de la realización de un examen de médula ósea y de los
procedimientos que se realizarán para la obtención y procesamiento de mi muestra.
Estoy de acuerdo en que se realicen todos los exámenes que mis padres han autorizado.
Fecha:__________________________________
Lugar:__________________________________
________________________________________
Sello de la institución
ANEXO No. 2: FOTOS DE RESULTADOS
A. FOTOS DE COMPROBACIÓN DEL GEN ABL.
FIGURA No. 63: GEN CONTROL ABL, PACIENTES No.1 y 2
Fuente FODECYT 48-2009
FIGURA No. 64: GEN CONTRL ABL, PACIENTES No. 3-7
276 bp
Fuente FODECYT 48-2009
FIGURA No. 65: GEN CONTROL ABL, PACIENTES No. 8 AL 14
276 bp
Fuente FODECYT 48-2009
FIGURA No. 66: GEN CONTROL ABL, PACIENTES No. 15 AL 20
Fuente FODECYT 48-2009
FIGURA No. 67: GEN CONTROL ABL, PACIENTES No. 21 AL 24
Fuente FODECYT 48-2009
FIGURA No. 68: GEN CONTROL ABL, PACIENTES No. 25 AL 27
Fuente FODECYT 48-2009
FIGURA No. 69: GEN CONTROL ABL, PACIENTES No. 27 Y 28
Fuente FODECYT 48-2009
FIGURA No. 70: GEN CONTROL ABL, PACIENTES No. 29 Y 30
Fuente FODECYT 48-2009
FIGURA No. 71: GEN CONTROL ABL, PACIENTES No. 31 AL 36
Fuente FODECYT 48-2009
FIGURA No. 72: GEN CONTROL ABL, PACIENTES No. 37 AL 39
Fuente FODECYT 48-2009
FIGURA No. 73: GEN CONTROL ABL, PACIENTES No. 40 AL 43
Fuente FODECYT 48-2009
FIGURA No. 74: GEN CONTROL ABL, PACIENTES No. 44 al 48
Fuente FODECYT 48-2009
FIGURA No. 75: GEN CONTROL ABL, PACIENTES No. 49 AL 51
Fuente FODECYT 48-2009
FIGURA No. 76: GEN CONTROL ABL, PACIENTES No. 52 AL 54
Fuente FODECYT 48-2009
FIGURA No. 77: GEN CONTROL ABL, PACIENTES No. 53 Y 54
Fuente FODECYT 48-2009
FIGURA No. 78: GEN CONTROL ABL, PACIENTES No. 56 AL 63
Fuente FODECYT 48-2009
FIGURA No. 79: GEN CONTROL ABL, PACIENTES No. 65 AL 73
Fuente FODECYT 48-2009
FIGURA No. 80: GEN CONTROL ABL, PACIENTES No. 8 AL 14
Fuente FODECYT 48-2009
FIGURA No. 81: GEN CONTROL ABL, PACIENTES No. 72 AL 75
Fuente FODECYT 48-2009
FIGURA No. 82: GEN CONTROL ABL, PACIENTES No. 75 AL 80
Fuente FODECYT 48-2009
FIGURA No. 83: GEN CONTROL ABL, PACIENTES No. 81 AL 85
Fuente FODECYT 48-2009
FIGURA No. 84: GEN CONTROL ABL, PACIENTES No. 84,86 Y 89
Fuente FODECYT 48-2009
FIGURA No. 85: GEN CONTROL ABL, PACIENTES No. 88 Y 93
Fuente FODECYT 48-2009
FIGURA No. 86: GEN CONTROL ABL, PACIENTES No. 90,92 Y 95
Fuente FODECYT 48-2009
FIGURA No. 87: GEN CONTROL ABL, PACIENTES No. 90, 94 Y 99
Fuente FODECYT 48-2009
FIGURA No. 88: GEN CONTROL ABL, PACIENTES No. 101-104
Fuente FODECYT 48-2009
FIGURA No. 89: GEN CONTROL ABL, PACIENTES No. 88, 96, 98 Y 102
Fuente FODECYT 48-2009
FIGURA No. 90: GEN CONTROL ABL, PACIENTES No. 97 Y 100
Fuente FODECYT 48-2009
FIGURA No. 91: GEN CONTROL ABL, PACIENTES No. 105-108
Fuente FODECYT 48-2009
FIGURA No. 92: GEN CONTROL ABL, PACIENTES No. 105, 107 Y 109
Fuente FODECYT 48-2009
FIGURA No. 93: GEN CONTROL ABL, PACIENTES No. 110 AL 114
Fuente FODECYT 48-2009
FIGURA No. 94: GEN CONTROL ABL, PACIENTE 115
Fuente FODECYT 48-2009
FIGURA No. 95: GEN CONTROL ABL, PACIENTES No. 116 AL 119
Fuente FODECYT 48-2009
FIGURA No. 96: GEN CONTROL ABL, PACIENTE No. 118
Fuente FODECYT 48-2009
FIGURA No. 97: GEN CONTROL ABL, PACIENTES No. 120 AL 125
Fuente FODECYT 48-2009
FIGURA No. 98: GEN CONTROL ABL, PACIENTE No. 126
Fuente FODECYT 48-2009
FIGURA No. 99: GEN CONTROL ABL, PACIENTE No. 127
Fuente FODECYT 48-2009
FIGURA No. 100: GEN CONTROL ABL, PACIENTES No. 128 AL 132
Fuente FODECYT 48-2009
FIGURA No. 101: GEN CONTROL ABL, PACIENTES No. 133 AL 138
Fuente FODECYT 48-2009
FIGURA No. 102: GEN CONTROL ABL, PACIENTES No. 139 AL 142
Fuente FODECYT 48-2009
B. FOTOS DE TRANSCRITOS
FIGURA No. 103: TRANSCRITO E2A-PBX1, PACIENTES No. 3 AL 7
Fuente FODECYT 48-2009
FIGURA No. 104: TRANSCRITO E2A-PBX1, PACIENTES No. 15 AL 20
Fuente FODECYT 48-2009
FIGURA No. 105: TRANSCRITO E2A-PBX1, PACIENTES No. 21 AL 27
Fuente FODECYT 48-2009
FIGURA No. 106: TRANSCRITO E2A-PBX1, ETV6-AML1 Y MLL-AF4
PACIENTES No. 28 AL 30
Fuente FODECYT 48-2009
FIGURA No. 107: TRANSCRITO E2A-PBX1, PACIENTES No. 30 AL 36
Fuente FODECYT 48-2009
FIGURA No. 108: TRANSCRITO E2A-PBX1, PACIENTES No. 37 AL 43
Fuente FODECYT 48-2009
FIGURA No. 109: TRANSCRITO E2A-PBX1, PACIENTE No. 43
Fuente FODECYT 48-2009
FIGURA No. 110: TRANSCRITO E2A-PBX1, PACIENTES No. 39 AL 48
Fuente FODECYT 48-2009
FIGURA No. 111: TRANSCRITO E2A-PBX1, PACIENTE No. 47
Fuente FODECYT 48-2009
FIGURA No. 112: TRANSCRITO E2A-PBX1, PACIENTES No. 49 AL 54
Fuente FODECYT 48-2009
FIGURA No. 113: TRANSCRITO E2A-PBX1, PACIENTES No. 57 AL 64
Fuente FODECYT 48-2009
FIGURA No. 114: TRANSCRITO E2A-PBX1, PACIENTES No. 53, 55, 57, 59, 61 Y
62
Fuente FODECYT 48-2009
FIGURA No. 115: TRANSCRITO E2A-PBX1, PACIENTES No. 60,63 Y 65
Fuente FODECYT 48-2009
FIGURA No. 116: TRANSCRITO E2A-PBX1, PACIENTES No. 65 al 74
Fuente FODECYT 48-2009
FIGURA No. 117: TRANSCRITO ETV6-AML1, PACIENTES No. 3 AL 7
Fuente FODECYT 48-2009
FIGURA No. 118: TRANSCRITO E2A-PBX1 Y ETV6-AML1,
PACIENTES No. 8 AL 14
Fuente FODECYT 48-2009
FIGURA No. 119: TRANSCRITO ETV6-AML1, PACIENTES No. 15 AL 20
Fuente FODECYT 48-2009
FIGURA No. 120: TRANSCRITO ETV6-AML1, PACIENTES No. 21 AL 27
Fuente FODECYT 48-2009
FIGURA No. 121: TRANSCRITO ETV6-AML1, PACIENTES No. 31 AL 36
Fuente FODECYT 48-2009
FIGURA No. 122: TRANSCRITO ETV6-AML1, PACIENTES No. 37 AL 43
Fuente FODECYT 48-2009
FIGURA No. 123: TRANSCRITO ETV6-AML1, PACIENTES No. 39 AL 48
Fuente FODECYT 48-2009
FIGURA No. 124: TRANSCRITO ETV6-AML1, PACIENTES No. 49 AL 51
Fuente FODECYT 48-2009
FIGURA No. 125: TRANSCRITO ETV6-AML1, PACIENTES No. 57 AL 64
Fuente FODECYT 48-2009
FIGURA No. 126: TRANSCRITO ETV6-AML1, PACIENTES No. 53 AL 62
Fuente FODECYT 48-2009
FIGURA No. 127: TRANSCRITO ETV6-AML1, PACIENTES No. 52 Y 54
Fuente FODECYT 48-2009
FIGURA No. 128: TRANSCRITO ETV6-AML1, PACIENTES No. 65 AL 74
Fuente FODECYT 48-2009
FIGURA No. 129: TRANSCRITO BCR-ABL, PACIENTES No. 1 y 2
Fuente FODECYT 48-2009
FIGURA No. 130: TRANSCRITO BCR-ABL, PACIENTES No. 3 AL 7
Fuente FODECYT 48-2009
FIGURA No. 131: TRANSCRITO BCR-ABL, PACIENTES No. 8 AL 14
Fuente FODECYT 48-2009
FIGURA No. 132: TRANSCRITO BCR-ABL, PACIENTES No. 15 AL 22
Fuente FODECYT 48-2009
FIGURA No. 133: TRANSCRITO BCR-ABL, PACIENTES No. 23 AL 27
Fuente FODECYT 48-2009
FIGURA No. 134: TRANSCRITO BCR-ABL, PACIENTES No. 27 AL 30
Fuente FODECYT 48-2009
FIGURA No. 135: TRANSCRITO BCR-ABL, PACIENTES No. 31 AL 36
Fuente FODECYT 48-2009
FIGURA No. 136: TRANSCRITO BCR-ABL, PACIENTES No. 37 AL 43
Fuente FODECYT 48-2009
FIGURA No. 137: TRANSCRITO BCR-ABL, PACIENTES No. 40 Y 41
Fuente FODECYT 48-2009
FIGURA No. 138: TRANSCRITO BCR-ABL, PACIENTES No. 39 AL 48
Fuente FODECYT 48-2009
FIGURA No. 139: TRANSCRITO BCR-ABL, PACIENTES No. 49 AL 51
Fuente FODECYT 48-2009
FIGURA No. 140: TRANSCRITO BCR-ABL, PACIENTES No. 57 AL 64
Fuente FODECYT 48-2009
FIGURA No. 141: TRANSCRITO BCR-ABL, PACIENTES No. 60, 63 Y 65
Fuente FODECYT 48-2009
FIGURA No. 142: TRANSCRITO BCR-ABL, PACIENTES No. 53, 55, 59,
62
Fuente FODECYT 48-2009
61 y
FIGURA No. 143: TRANSCRITO BCR-ABL, PACIENTES No. 52 y 54
Fuente FODECYT 48-2009
FIGURA No. 144: TRANSCRITO BCR-ABL, PACIENTES No. 65 al 74
Fuente FODECYT 48-2009
FIGURA No. 145: TRANSCRITO MLL-AF4, PACIENTES No. 3 AL 7
Fuente FODECYT 48-2009
FIGURA No. 146: TRANSCRITO MLL-AF4, PACIENTES No. 8 AL 14
Fuente FODECYT 48-2009
FIGURA No. 147: TRANSCRITO MLL-AF4, PACIENTES No. 15 AL 20
Fuente FODECYT 48-2009
FIGURA No. 148: TRANSCRITO MLL-AF4, PACIENTES No. 21 AL 27
Fuente FODECYT 48-2009
FIGURA No. 149: TRANSCRITO MLL-AF4, PACIENTES No. 31 AL 36
Fuente FODECYT 48-2009
FIGURA No. 150: TRANSCRITO MLL-AF4, PACIENTES No. 37 AL 43
Fuente FODECYT 48-2009
FIGURA No. 151: TRANSCRITO MLL-AF4, PACIENTES No. 39 AL 48
Fuente FODECYT 48-2009
FIGURA No. 152: TRANSCRITO MLL-AF4, PACIENTES No. 49 AL 51
Fuente FODECYT 48-2009
FIGURA No. 153: TRANSCRITO MLL-AF4, PACIENTES No. 52 y 54
Fuente FODECYT 48-2009
FIGURA No. 154: TRANSCRITO MLL-AF4, PACIENTES No. 53 al 62
Fuente FODECYT 48-2009
FIGURA No. 155: TRANSCRITO MLL-AF4, PACIENTES No. 57 al 64
Fuente FODECYT 48-2009
FIGURA No. 156: TRANSCRITO MLL-AF4, PACIENTES No. 65 AL 74
Fuente FODECYT 48-2009
FIGURA No. 157: TRANSCRITO BCR-ABL Y EE2-PBX1, PACIENTES No.72 AL
75
Fuente FODECYT 48-2009
FIGURA No. 158: TRANSCRITO ETV6-AML1 Y MLL-AF4, PACIENTES DEL 72
AL 75
Fuente FODECYT 48-2009
FIGURA 158: TODOS LOS TRANSCRITOS, PACIENTES DEL 76 AL 80
Fuente FODECYT 48-2009
FIGURA No. 159: TODOS LOS TRANSCRITOS, PACIENTES DEL 81 AL 85
Fuente FODECYT 48-2009
FIGURA No. 160 : TRANSCRITO BCR-ABL, E2A-PBX1, PACIENTES DEL 90-96,
99 Y 100
Fuente FODECYT 48-2009
FIGURA No. 161: TODOS LOS TRANSCRITOS, PACIENTE 102
Fuente FODECYT 48-2009
FIGURA No. 162: TODOS LOS TRANSCRITOS, PACIENTES 84, 86 Y 89
Fuente FODECYT 48-2009
FIGURA No. 163: TRANSCRITO BCR-ABL; PACIENTES 88, 101 AL 104
Fuente FODECYT 48-2009
FIGURA No. 164: TODOS LOS TRANSCRITOS, PACIENTES 105 AL 109
Fuente FODECYT 48-2009
FIGURA No. 165: TRANSCRITO BCR-ABL, E2A-PBX1, PACIENTES 115 AL 119
Fuente FODECYT 48-2009
FIGURA No. 166: TODOS LOS TRANSCRITOS; PACIENTES No. 110 AL 114
Fuente FODECYT 48-2009
FIGURA No. 167: TRANSCRITO BCR-ABL Y E2A-PBX1, PACIENTES DEL 120
AL 132
Fuente FODECYT 48-2009
FIGURA No. 168: TODOS LOS TRANSCRITOS, PACIENTES 121, 123 ,125 Y 126
Fuente FODECYT 48-2009
FIGURA No. 169: TRANSCRITO BCR-ABL, PACIENTES No. 133 AL 142
Fuente FODECYT 48-2009
FIGURA No. 170: TRANSCRITO E2A-PBX1 Y ETV6-AML1, PACIENTES 133 A
142
Fuente FODECYT 48-2009
FIGURA No. 171: TRANSCRITOS BCR-ABL Y ETV6-AML1, PACIENTES 121,
123, 120 Y 128
Fuente FODECYT 48-2009
FIGURA No. 172: TRANSCRITOS ETV6-AML1 Y MLL-AF4, PACIENTES 115 AL
119
Fuente FODECYT 48-2009
FIGURA No. 173: TRANSCRITO ETV6-AML1, PACIENTES 120, 123, 124, 127-131
Fuente FODECYT 48-2009
FIGURA No. 174: TRANSCRITO MLL-AF4, PACIENTES 133 AL 142
Fuente: FODECYT 48-2009
ANEXO No. 3:
GRAFICAS DE SECUENCIACIÓN
ANEXO No. 4
TABLA 12: DATOS CLÍNICOS DE LOS PACIENTES
PARTE V
V.1 INFORME FINANCIERO